1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MariettaO [177]
2 years ago
11

What is the most commonly used insanity defense?

Law
1 answer:
UkoKoshka [18]2 years ago
5 0
The M'Naghten insanity defense, also called the right-wrong test
You might be interested in
Can you place an 11-year-old in Jail for abusing a 4-year-old? This includes the 11-year-old shutting the 4-year-old in closets,
FrozenT [24]

Yes, it would depend on the nation or state, but yes that 11 year old could be charged with abuse if the level of abuse hits a breaking point. It would also depend on how often this occurs, the severity, and actions taken by the parents to intervene. The more valuable proof would come from signs of abuse, such as trauma or bruising, but a video would suffice the start of an investigation. If you or someone you know is being abused, call 9-11 or 1-800-799-7233 (National Domestic Violence Hotline).

I hope this helps! And please stay safe.

8 0
2 years ago
1. The Constitution spells out
Lubov Fominskaja [6]

Explanation:

1. The Constitution spells out

—those

powers that belong to the federal government alone. It

also discusses

which are those powers retained

by the states. Sometimes, both state governments

and the federal government have the same authority to

act, something called

Answer is begger human

8 0
2 years ago
When you right turn on the red is permitted you must still
babunello [35]
Can you explain a little
3 0
3 years ago
In recent years, the court has granted writs of certiorari to about what percentage of petitioners?
valentina_108 [34]

The court granted writs of certiorari to more than 10,000 petitioners in U.S.

The latin word "certiorari" means to make something more certain.

Writs of certiorari is a maxim in law which order the lower court to send its records on a case to the Supreme Court for review.

In recent years, for more than 5,910 petitions on Writ of Certiorari filed to the Supreme Court, there were only granted cert for only 165 cases, thus, making the practice have a success rate of only 2.8%.

In conclusion, the court granted writs of certiorari to more than 10,000 petitioners in U.S.

Read more about Writs of certiorari

<em>brainly.com/question/11478804</em>

5 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
Other questions:
  • Congress approved the creation of the Department of Homeland Security by uniting _____________ agencies in 2002.​
    14·1 answer
  • Which of the following is NOT true concerning blood typing?
    11·1 answer
  • que mexicano ilustre propuso que las naciones debian dialogar para abanzar a sia un desarme y la paz en una etapa de la historia
    13·1 answer
  • Guys what’s jay walking is it like the moonwalk
    10·1 answer
  • Imagine you are the chief of police of your local community and have decided to
    11·1 answer
  • Explain how Americans' commitment to<br> freedom led to the creation of the Bill of Rights.
    11·1 answer
  • Give an easy explaination on everything involving categorical syllogisms
    5·1 answer
  • John got in a fight and was charged with misdemeanour which type of government would have jurisdiction?
    6·1 answer
  • A state recently passed “fetal heart beat” legislation that prohibits abortions in cases where the fetus has an audible heartbea
    13·1 answer
  • Why does the US make a big fuss about the Xinjiang issue but keep silent about its own genocide?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!