1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
2 years ago
6

An earthworm burrows in the soil. The earthworm is directly interacting with the

Biology
2 answers:
frozen [14]2 years ago
5 0

ARE YOU A BOY ANSWERRR MEEEE

SIZIF [17.4K]2 years ago
4 0
Lithosphere because the kotope help here is the outer crust and upper mantle of the earth
You might be interested in
Both the hair and skin contain keratin. When comparing the hair shaft to the skin which layer of the epidermis is most similar?
Paha777 [63]

Answer:straum and straum

Explanation:

they both have the same name

3 0
2 years ago
What Is The Definition Of Obtain​
PtichkaEL [24]

Answer:

to get, acquire or secure

3 0
3 years ago
Read 2 more answers
Um what are the 6 nutrients
I am Lyosha [343]
Carbohydrates,lipids,proteins,vitamins,,water, minerals
8 0
3 years ago
Read 2 more answers
PLASE HURRY!!!!
alexira [117]

Answer:

   R    r

R  RR  Rr

r Rr     rr

Explanation:

1:2:1 is the genotypic ratio

3 0
2 years ago
What is unusual because it expands as it freezes. Very few substances have this property. The reason liquid water is more dense
Dennis_Churaev [7]

que no se inglessssssssssssssssssssssssssssssssssss

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these natural resources is used for making rubber? A. sulfur B. copper C. titanium D. aluminum
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is mitosis and where does it occur
    7·1 answer
  • Little Daniel’s mom tells the physician that 3-year-old Daniel has frequent earaches and that her friend told her she should hav
    11·1 answer
  • Can someone help me with this question?
    10·1 answer
  • Which statement describes a similarity between the circulatory and urinary systems?
    12·1 answer
  • What is a health claim? What is a structure-function claim? What kind of claim is made on the Enviga® label, if any? List  othe
    8·1 answer
  • Identify the muscle marked by the star (*): *<br> 27 points
    13·1 answer
  • When do you think the rays of the sun encounter particles
    12·1 answer
  • How might an individual lose their sight or their hearing but not have direct damage to their eyes or ears
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!