1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wolverine [178]
3 years ago
12

Which climate zone generally receives the least amount of the

Biology
1 answer:
Stels [109]3 years ago
3 0

Answer:

d) subpolar zone

What do climate zones mean?

A climate zone is a world area or region distinguished from a neighbor by a major physical climatic characteristic that is of global scale.

You might be interested in
Which statement describes the function of the plasma membrane?
MrRa [10]
<span>B, it recognizes substances and other cells it comes in contact with.</span>
3 0
3 years ago
Read 2 more answers
Given that polyurethane is a huge polymer (mw &gt;&gt;?????????,????????? daltons), why is it important that the polyurethanase
Viefleur [7K]

Polyurethanase is an enzyme emitted by the microorganism so as to break polyurethane. Since the polymer is a significant wellspring of energy for the life form, it should be separated all together for etpum"s development.

Further details

Polyurethane

It is a polymer made out of organic units and carbamate links join them. While most polyurethanes are thermosetting polymers that don't liquefy when warmed, thermoplastic polyurethanes are likewise accessible. Polyurethanes are available in numerous parts of present-day life. They present a class of polymers that have discovered a far-reaching use in the medical and mechanical fields. Polyurethanes can be found in items such as furniture, coatings, cement, constructional materials, paints, elastomers, filaments and paddings. Polyurethane ought to be curtailed to PUR in consistence with authority German and International benchmarks.

Polyurethanase

It can be defined as such an enzyme which is secreted by microbes and used for the breakdown of polyurethane. In this breakdown process energy is released that is utilized by microorganisms.

Bio-degradation of Polyurethane

In spite of their microbial obstruction, polyurethane is attacked by microscopic organisms however the component to explain its bio-degradation is unknown. There are reports from microscopic organisms and parasites that are equipped for the breakdown of polyurethane yet the examinations about the proteins that assault the plastic are centered around bacterial compounds as it were. The enzyme is of sort esterase and protease for the most part since these chemicals are unspecific and can perceive a few regions in the polyurethane particle and hydrolyze it.

Answer details

Subject: Biology

Level: College

Keywords

  • Polyurethane
  • Polyurethanase
  • Bio-degradation of Polyurethane

Learn more to evaluate

brainly.com/question/10560288

brainly.com/question/12603071

5 0
3 years ago
Read 2 more answers
The distance time graph for four objects is shown below:
Damm [24]

Answer:

Object A

Explanation:

5 0
3 years ago
Read 2 more answers
Models of both atmospheric and oceanic circulation show predictable patterns of air and water movement across the globe. The
marusya05 [52]

Coriolis effect is the phenomenon that most directly causes these atmospheric and oceanic circulation patterns.

<h3>What is Coriolis effect?</h3>

This is defined as an apparent deflection of the path of an object that moves within a rotating coordinate system.

Atmospheric and oceanic circulation patterns aride from deflection of the direction of air and water currents moving towards or away from the poles.

Read more about Coriolis effect here brainly.com/question/3650165

5 0
2 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Producers<br> ition. Their make their
    13·1 answer
  • If many different species live in an ecosystem, this helps the ecosystem to fill its _______.
    8·1 answer
  • Of the pH values below, which is considered "neutral" pH? A. 7.4 B. 9 C. 5.4 D. 7
    6·1 answer
  • Water acts as a ____:<br> A) Solvent<br> B) Solute<br> C) Solution<br> D) Mixture
    7·2 answers
  • Which process is not a way in which cells maintain homeostasis?
    12·2 answers
  • Which process best explains how antibiotic resistance in bacteria can occur?
    12·1 answer
  • what process allows plants to convert sunlight energy into chemical energy
    5·1 answer
  • Which example from the text develops the idea that the
    15·2 answers
  • Answer the question below
    12·2 answers
  • Both parents are dominant tall, naklne the 4 possible offspring
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!