1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ExtremeBDS [4]
3 years ago
10

What is the smallest unit in biology ?​

Biology
2 answers:
Softa [21]3 years ago
8 0

Answer:

Cells

Explanation:

A cell is the smallest unit of a living thing. A living thing, whether made of one cell (like bacteria) or many cells (like a human), is called an organism. Thus, cells are the basic building blocks of all organisms.

erma4kov [3.2K]3 years ago
6 0

Answer:

A cell is the smallest unit of a living thing.

You might be interested in
What volume would a 20.0 kilogram sample have if it’s density is known to be 19.3 g/cm^3 does it sink or float? Is this a solid
balandron [24]

Answer:

it is a solid and it will sink the volume is 39.3 kilograms

Explanation:

4 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Which statements explain how ponds and lakes differ? Select two options.
dybincka [34]

Answer:

A. ponds are shallower than lakes

E. lakes are colder and darker at the bottom than ponds

6 0
3 years ago
WILL GIVE BRAINLIEST!!!!!<br> All living things are made of carbon.<br><br> True<br><br> False
Nesterboy [21]

Answer:

False they are not ENTIRELY made up of carbon but have some in their/its body.

Explanation:

hope this helps :3

5 0
4 years ago
Fossils show how the complexity of living organisms has changed over time. Gerobatrachus hottoni was a unique organism that live
lara31 [8.8K]

The correct answer is transitional.  

Gerobatrachus refers to an extinct genus of amphibamid temnospondyl, which thrived in the initial Permian, that is, about 290 mya, in the region, which is now known as Baylor County, Texas. The transitional form of fossils are those that demonstrate the intermediate form between the two distinct living species, it could be in a form of an ancestor and its descendants. It is considered that the frogs and salamanders have evolved from a common ancestor of primitive amphibian tetrapod subclass known as Temnospondyli.  


4 0
3 years ago
Other questions:
  • The diagrams are showing a cell undergoing a mitotic division at different points of Anaphase.use the ABC labels on the drawings
    7·2 answers
  • Select the statements about the k-t boundary that are true. select all that apply. select all that apply. the k-t boundary is a
    12·1 answer
  • Select all that apply. Chromosomes _____.
    13·2 answers
  • Refer to Lab 4.04, Part 3. A man who is color-blind marries a woman who is not color-blind and is not a carrier of the allele fo
    10·2 answers
  • Cohesion describes the attraction between a water molecule and another type of polar molecule
    11·2 answers
  • Describe evaporation in ur own words
    11·2 answers
  • Describe the process of transferring from photosynthesis to respiration
    9·1 answer
  • (_______) stars, however, will last for several billion years, because
    5·1 answer
  • Which of the following are examples of a new substance being formed . check all that apply A )bubbles
    13·1 answer
  • Define target cell and explain why all cells are not target cells for all hormones
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!