1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bekas [8.4K]
2 years ago
12

What term is used to describe the state at which a solute moves down its concentration gradient

Biology
1 answer:
anzhelika [568]2 years ago
8 0
4.solvent I’m pretty sure
You might be interested in
How are protozoans differentiated by mean of their locomotary organelles?
Afina-wow [57]

the locomotary organs are cillia, flagella and pseudopodia or is called false feet

7 0
3 years ago
Read 2 more answers
How does the Earth-<br> sun-moon system<br> affect life on Earth?
klemol [59]

Answer:

Hello!!! Princess Sakura here ^^

Explanation:

The sun, earth, and moon are held together by gravity, and they interact in lots of ways. The moon orbits the earth because of the pull of the earth. The tides are another interaction in the sun, earth, and the moon system. The tides happen because the moon and sun pull on the oceans, causing them to rise and fall each day.

7 0
3 years ago
During cellular respiration, NADH:________.a. is converted to NAD+ by an enzyme called dehydrogenase. b. none of the choices are
skad [1K]

Answer:

a. is converted to NAD+ by an enzyme called dehydrogenase

Explanation:

The electron transport chain of cellular respiration is the final step that oxidized NADH and FADH2. These reducing powers are formed during glycolysis and Kreb's cycle. Complex I of the electron transport chain present in the inner mitochondria membrane is NADH dehydrogenase. This protein complex accepts electrons from NADH and oxidizes it into NAD+. NADH dehydrogenase couples oxidation of NADH with the pumping of proton towards the intermembrane space.

5 0
3 years ago
What distinguishes the savanna and grassland biomes?<br>the aswer is a
elena-s [515]
Hello! THere are many differences between a grassland and a savanna. For one, a savanna is a grassland, however, A savanna is usually very dry. A savanna also has very few trees, while grasslands can be plush with many trees. Grasslands could also be in mountains while savannas are vast dryer lands with animals who live in dry weather. Grasslands also contain a lot of water sources like lakes, rivers, ponds, and savannas usually don't. Those are just a few o the many differences between them! 

I hope this helped!

I am, yours most sincerely,
SuperHelperThingy
5 0
3 years ago
What three features of seabirds are specifically adaptive for life at sea
Ilya [14]
1.Beak for catching prey
2.Wings to fly away from danger
3. Ability to balance
7 0
3 years ago
Other questions:
  • Which community found in Figure 5-4 is the most diverse?
    8·1 answer
  • Why can skin regenerate effectively even after considerable damage?
    7·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A zoologist has been studying the annual migration of a species over a period of years. He missed the annual event on two occasi
    14·2 answers
  • Explain what the relationship between soils and acid deposition is?
    13·1 answer
  • Why we name that ATP is an energy “station” of the cell?
    10·1 answer
  • review the setup for photosynthesis select all primary limiting factors that impact the rate of photosynthesis for this lab setu
    5·2 answers
  • Which connective tissue protein fibers form a meshlike framework that provides structural support for many organs?
    8·1 answer
  • How can plasmids differentiate species and can you tell by looking at it?
    8·1 answer
  • A car travels 300 km in 6 hours. What's the average speed of the car? O 50 km/h O 65 km/h O 45 km/h O 75 km/h​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!