1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga nikolaevna [1]
3 years ago
9

Can someone help me with this question I’m not getting it

Biology
1 answer:
RSB [31]3 years ago
5 0

Answer:

a. X^BY

b. X^BX^B

c. X^{b} Y

d. X^BX^b

e. X^bX^b

Explanation:

There are two sex chromosomes, X and Y. A female has two X chromosomes and the male has an X and a Y. The genotype then for male and female woud be:

Female = XX

Male = XY

Now the superscript indicates the allele for a particular trait.

Based on what was given:

H is dominant (no hemophilia)

h is recessive (hemophilic)

B is dominant (no color blindness)

b is recessive (color blind)

As you can see in the given, the Y chromosome has no allele, this means that hemophilia and color-blindness is X-linked or dependent on the X chromosome.

For the first, it says normal male this means that the genotype would be XY , the X chromosome would have the normal dominant allele for color-blindness so that would be B.

X^BY

The next one would be homozygous normal female. This means that the female has both dominant alleles on their chromosome (BB)

X^BX^B

The third one says colorblind male. Unlike the females, the male chromosomes only need the X to be affected for them to express the trait. So in this case, the X will have the recessive allele for colorblindness (b).

X^{b} Y

The foruth one is a normal female for color-blindess but is heterozygous. This means that the female has the recessive allele, but the dominant trait masks it. So it will have both alleles (Bb)

X^BX^b

Lastly, a color-blind female would have to have two recessive alleles. This is what we call homozygous recessive (bb).

X^bX^b

You might be interested in
Fermentation and aerobic respiration break down glucose to make
Eddi Din [679]

Answer:

D

Explanation:

Fermentation produces a net gain of 2 ATPs

Aerobic respiration produces a net gain of 32 ATPs

6 0
3 years ago
Gentoo penguins will present a mate with a pebble that they find to attract a mate. Emperor penguins have a specific call and mo
Mrac [35]
<span>B is the right answer. Gentoo and Emperor penguins employing different mating rituals is an example of behavioral isolation. Behavioral isolation is the umbrella term for a host of differences between species, although in the case of different mating behaviors this variety of behavioral isolation is intended to prevent cross-breeding between different members of the same species in the same environment.</span>
7 0
3 years ago
Read 2 more answers
Please help! I need to know your opinions. If you don't have one or aren't in high school then don't answer because I'll report.
jeka94

Answer:

I am in high school but put me in as collage!

Explanation:

B. Astronomy

please mark brainliest have a good day:)

5 0
3 years ago
Read 2 more answers
True or false the genotype of an organism constitutes its observable characteristics
iren2701 [21]
False

The genotype of an organism does not constitute its observable characteristics but rather its phenotype. A genotype of an organism is the genetic makeup of an organism while the phenotype is the visible characteristics.
It is, however, significant to understand that the phenotype of an organism is as a result of the interaction between the genotype and the environment. 
4 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • According to the pie chart, which cause results in the most extinctions?
    15·2 answers
  • The following specimens/slides were shown to the students: mushroom, moss, earthworm, volvox, bacteria. The teacher asked them t
    5·1 answer
  • What is one factor that affects the explosivity of magma
    8·2 answers
  • Please answer asap!<br><br> what were the two factors that caused differences in wind speed?
    5·1 answer
  • The units that determine the inheritance of biological characteristics
    11·2 answers
  • Can u guys help me answering the following Test Guide and using complete sentences
    6·1 answer
  • What are the two main ways a star can live based on it mass?
    13·2 answers
  • In a typical plant, when are stoma generally open?
    8·1 answer
  • Think about how acids and bases would affect the water quality in the two lakes. which set of ph data would you expect to see ba
    5·2 answers
  • which graph represents a species that has a smaller gestation and maturation period, smaller number of offspring, and little or
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!