1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olenka [21]
2 years ago
5

Suggest TWO different ways by which the deficiency disease caused by a lack

Biology
1 answer:
krok68 [10]2 years ago
8 0

Answer: hey i have that problem (anemia) causes passing out and excessive bleeding in the nose.

this could be treated by 1. iron supplements taken by mouth.

2. Foods high in iron and foods that help your body absorb iron (like foods with Vitamin C).

Explanation:

You might be interested in
How do ocean temperatures affect local weather?
Gnom [1K]
Oceans bring warm water to distant shores. Ocean temperatures and winds are coupled into a complex interactive system. Varying ocean temperatures affect local atmospheric pressure, which creates regional wind patterns that, in turn, drive oceanic currents that affect surface ocean temperatures.
8 0
3 years ago
How exactly did life begin?
jok3333 [9.3K]
Monkeys 0.0 so yuppppp
4 0
3 years ago
Read 2 more answers
What is the "scale of cells"?
Nitella [24]
Cell Size and Scale, an elegant and deceptively simple interactive from the University of Utah's Genetic Science Learning Center, enables you to compare the sizes of various really small things. The interactive is available free on the Internet and works on desktop computers, smart phones, and tablets.
5 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Which statement best describes how a diagram of photosynthesis would differ for a diagram of cellular respiration?
Anna [14]

Answer:D

Explanation:

Photosynthesis main energy source is solar energy while cellular respiration uses chemical energy

4 0
3 years ago
Other questions:
  • Which species in the United States are protected under the Endangered Species Act?
    13·2 answers
  • Plants use photosynthesis to make<br> A. sugar<br> B. carbon<br> C. carbon dioxide<br> D. water
    8·2 answers
  • Galaxies are groups or systems of:
    6·2 answers
  • Carbon, an important element for life, keeps cycling between the spheres of the Earth. Carbon dioxide in the_____ (atmosphere)(b
    9·2 answers
  • Who proposed that the structure of DNA is a double helix
    6·2 answers
  • A student listed characteristics of a classroom aquarium ecosystem. Which
    5·1 answer
  • The series of events in a eukaryotic cell that involve growth
    15·1 answer
  • Which of the following is true about the glucose molecule during the process of cellular respiration?
    14·2 answers
  • Which statement best explains what happens to a leaf when it has lost much-needed water?
    10·2 answers
  • Planet A
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!