1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanya [424]
3 years ago
9

Determine if these statements are true or false: Introns represent a genome scrap

Biology
1 answer:
Tanzania [10]3 years ago
6 0
I think the answer would be: #2 - true; false
You might be interested in
The liquid component of of a solution is the Solvent, and the solid component of a solution is the solute.
aalyn [17]

Answer:

That is true.

Hope this helps

7 0
3 years ago
What takes charge of the body's involuntary functions outside conscious awareness
uranmaximum [27]
It is the central nervous system that takes charge of the body's involuntary functions outside conscious awareness. It is this system that is responsible for all of the body's involuntary acts, such as breathing, blinking, etc. 
3 0
3 years ago
A nurse co worker who uses passive aggressive communication
likoan [24]
<span>Answer: Passive aggressive communication avoids honest, direct communication and expresses her concerns to others in an attempt to make other people look bad.</span>
4 0
3 years ago
Describe Natural influences in the Alpine Biome. 10 Points total.
Arisa [49]
<span>In general, as one ascends a mountain, temperature drops by about 10 C for every 1000 meters in altitude gained (a suspiciously round number!). 
I hope I helped!!</span>
7 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Explain the difference between a waves period and frequency
    13·1 answer
  • What are the economic impacts of any of the parasitic crustaceans on any of the commercial or sport fisheries?
    11·1 answer
  • List two types of destructive rock formation
    8·1 answer
  • Homeostasis is defined as
    6·2 answers
  • Is it possible to find the same gene in two different kinds of organisms but not find the protein that is produced from that gen
    13·1 answer
  • Diego is studying compost. He conducted an experiment to see how moisture levels affect the breakdown of organic materials in co
    15·1 answer
  • Which of the following is a common danger of commercial fishing?
    11·1 answer
  • What are some ways to keep your bones healthy?(name atleast 3)
    7·1 answer
  • A book is sliding along a desktop. Because the book is in motion, you know that the forces acting on the book are ______? What i
    6·1 answer
  • PLEASE HELP ILL MARK BRAINIEST. Complete the table using the codon chart. THANK YOU!!
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!