1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Norma-Jean [14]
2 years ago
6

I've never asked a question before but here is something to think about:

Geography
2 answers:
kompoz [17]2 years ago
8 0

Answer:

I think you would be American

Explanation:

Because Mexico is a country in North America so I think that makes you automatically American.

Rainbow [258]2 years ago
8 0

Answer:

It depends, if America has enough space and meets the right person you will be an American but technically speaking no you are actually a Mexican because you are not actually in American territory

Explanation:

You might be interested in
What is the EPA’s role in environmental regulation?
ozzi

Explanation

EPA stands for Environmental Protection Agency was founded in the year 1970 in the month of December.

 EPA’s role in environmental regulation are:

  • EPA's role to protect, analyzing, Monitoring the environment.
  • Implementation of the environmental law.
  • Environmental guidance and plan.
  • EPA goal is to improve the environment condition and contribute to making our ecosystems sustainable.
  • The EPA controls the distribution, production, processing, and handling of chemicals and pollutants.
  • Assuring the Safety of Chemicals so that it does not cause any harm to the environment.

4 0
3 years ago
The philosopher Voltaire wrote in favor of
Deffense [45]

Answer:

<em>Religious Toleration </em>

Explanation:

Voltaire argues in favour of toleration of religious belief, while reserving the right to argue strenuously against it, and denouncing religious fanaticism of all stripes.

Hope this helps.

8 0
3 years ago
Read 2 more answers
Can someone help me with 33
Oksanka [162]
Can you help me with my questions please
8 0
3 years ago
A recent study indicates that a certain drug may be useful in treating a certain disease. Which of these questions is least like
Arada [10]
The answer is a I just took the test
8 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • Where do tectonic activities, such as earthquakes or volcanic eruptions, tend to occur?
    14·2 answers
  • Write down about the economic activities and lifestyle of people living in the western Mountains in pakistan
    7·2 answers
  • Cual es el valor de la producción petrolera en México?
    9·1 answer
  • When does a tropical storm reach Category 1 intensity?
    15·2 answers
  • _______________ referred to by Arab geographers by a name that means "Mountain of Language" because it was a meeting place for p
    5·1 answer
  • Help brainiest if correct
    5·1 answer
  • How does a cave turn into a stack? <br><br><br><br><br><br><br>Explain please (if you can) ​
    11·2 answers
  • Which of the following best explains why sand
    10·1 answer
  • _________ is considered the largest island in the world and is located northeast of North America.
    13·2 answers
  • A modern controversy by some maverick, so-called historians wishes to prove that the Great Pyramid of Egypt was built more than
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!