1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mafiozo [28]
2 years ago
13

During radioactive decay, atoms of a radioactive element break down and change into other atoms of another element-all at once

Biology
1 answer:
const2013 [10]2 years ago
7 0
This is true I looked up in the science dictionary.
You might be interested in
Which part of the membrane can catalyze chemical reactions?
kenny6666 [7]

Answer:

the correct answer is enzymes

Explanation:

enzyme act as catalyst and is a biological molecule which within the cell membrane can speed up or increase the rate of biological reaction without affecting itself and is obtained unchanged at the end of reaction

8 0
2 years ago
Read 2 more answers
The smallest predator prey-cycle consists of ---
tamaranim1 [39]
D is the correct answer ur welcome
3 0
2 years ago
Read 2 more answers
Help me with this pleaseeeeeeeeeee
KatRina [158]
A: Energy hope this helps
6 0
3 years ago
During the day what typically happens to air pressure? During the night what typically happens to air temperature?
dolphi86 [110]
A sea breeze describes the wind that blows from the ocean inland towards land. This breeze occurs most often in the spring and summer months because of the greater temperature differences between the ocean and nearby land, particularly in the afternoon when the land is at maximum heating from the sun. 
During the day, the sun heats up both the ocean surface and the land. Water is a good absorber of the energy from the sun. The land absorbs much of the sun’s energy as well.  However, water heats up much more slowly than land and so the air above the land will be warmer compared to the air over the ocean. The warm air over the land will rise throughout the day, causing low pressure at the surface. Over the water, the high surface pressure will form because of the colder air. To compensate, the air will sink over the ocean. The wind will blow from the higher pressure over the water to lower pressure over the land causing the sea breeze. The sea breeze strength will vary depending on the temperature difference between the land and the ocean.
At night, the roles reverse. The air over the ocean is now warmer than the air over the land. The land loses heat quickly after the sun goes down and the air above it cools too.  This can be compared to a blacktop road. During the day, the blacktop road heats up and becomes very hot to walk on. At night, however, the blacktop has given up the added heat and is cool to the touch. The ocean, however, is able to hold onto this heat after the sun sets and not lose it as easily. This causes the low surface pressure to shift to over the ocean during the night and the high surface pressure to move over the land. This causes a small temperature gradient between the ocean surface and the nearby land at night and the wind will blow from the land to the ocean creating the land breeze.
3 0
2 years ago
Read 2 more answers
The liquid phase of water is called...
daser333 [38]
  <span>there are three phases of water ...</span><span> gas (steam), </span>liquid<span> (</span>water), and solid (ice)  ..   The liquid phase of water is called water ...

Hope it helps !!!

5 0
3 years ago
Read 2 more answers
Other questions:
  • In a savanna, gazelles, wildebeests, and warthogs eat grasses. Lions and cheetahs eat gazelles and wildebeests. Lions and wild d
    13·1 answer
  • The force of an attraction that the earth exerts on all objects is called _____
    5·2 answers
  • Carefully looking at an object or process please help :)
    6·1 answer
  • What is the displacement for a driver who travels 10 km to get to a point that is 4 km from his starting point? 10 km 6 km 4 km
    11·1 answer
  • If a carbon atom is bonded to two hydrogen atoms and two carbon atoms, what type of bond must exist between the carbor
    8·1 answer
  • Which is a weakness of traditional food webs when they are applied to complex ecological problems?
    15·1 answer
  • How many of the following statements about DNA are true? a. A-DNA and B-DNA form left-handed helices. b. G and C nucleotides bas
    13·1 answer
  • What is the difference between a species and a population?
    12·1 answer
  • Sum It Up
    11·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!