AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
Hello! Your answer would be, D)Fertilization
Explanation:
Hope I helped! Ask me anything if you have any questions! Brainiest plz! Hope you make an 100% and have a wonderful day! -Amelia♥
<span>ny scientist studying a species could change the name. These long ... To classify organisms, scientists use similarities and differences among species. ... MATERIALS ... also use genetic evidence, which is found within an organism's DNA.</span>
Should there be answer choices that go with this question?
If not here is an answer that may help.
This is how the cycling between photosynthesis<span> and cellular respiration occurs: </span>in photosynthesis<span>, carbon dioxide and water, </span>in<span> the presence of light energy, are converted to make glucose and oxygen.</span>
