1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ozzi
2 years ago
15

Hoa đều lưỡng tính có năm lá đài phụ dính liền năm lá đài chín rồi hai vòng cánh hoa mỗi vòng có năm cánh hoa liền nhau bộ nhị c

ó năm nhị rời, bộ nhuỵ có năm nhuỵ liền nhau dính bầu nõn thượng.
Biology
1 answer:
baherus [9]2 years ago
6 0

<em>Hoa thức hay công thức hoa là một phương tiện thể hiện cấu trúc của một hoa bằng số, chữ cái và các ký hiệu khác nhau, trình bày ngắn gọn các thông tin quan trọng về cấu tạo hoa. Nó có thể đại diện cho các loài cụ thể, hoặc dùng để mô tả các bậc phân loại cao hơn. Thông tin của hoa thức chủ yếu gồm hình dạng hoa, số lượng cơ quan của hoa và mối liên hệ giữa các thành phần trong cơ quan đó. Hoa thức là một trong hai cách mô tả cấu trúc hoa được phát triển trong thế kỷ 19, cách còn lại là hoa đồ</em>

You might be interested in
True or false: Phosphorus will cycle through the atmosphere as one of its “stops”
Ipatiy [6.2K]
I’m not sure of my answer I think it’s false
4 0
4 years ago
Drag each label to the correct location chart. Match the traits to the organism
Jobisdone [24]

Answer:

Look at the image below

Explanation:

Hope this helps!!!!!

7 0
3 years ago
A population is a population is a group of individuals of the same species that live in the same area and interbreed. all indivi
neonofarm [45]
C. a group<span> of</span>individuals<span> of a </span>species plus all<span> of the </span>other species<span> with which </span>they<span> intera</span>
6 0
3 years ago
How do small particles cross a cell membrane?
lora16 [44]
Active transport requires that the cell move engegy that it has obtained the food to move the molecule threw the cell membrane.The passive transport doesn't required as much energy for the molecule to move....
5 0
3 years ago
Name the eight levels of classification from most general to most specific
Tems11 [23]
It is domian, kingdom, phylum,class,order, family, species. aka. King Philip coughed on Fred and then he got sick
4 0
3 years ago
Other questions:
  • Which organelle packages the material used to build the cell plate in plant cells
    8·1 answer
  • Of the following, which is the most inclusive level of organization in nature?
    11·1 answer
  • What are enzymes? Give an example
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Plzzzzz help me ASAP . WILL MARK AS BRAILEIST
    15·2 answers
  • Which of the following features help plants stay upright? (Select all that apply.)
    6·2 answers
  • Which of these actions has contributed to the increase of greenhouse gases in the atmosphere?
    6·1 answer
  • Can someone help me? ​
    11·1 answer
  • If a plant cell completes the cell cycle in 24 hours, how many plants cells will be produced in a week?
    5·1 answer
  • Is the trait from the pedigree below autosomal or X-linked? How do you know?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!