1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stepan [7]
3 years ago
6

Is WATER a carbohydrate, protein, or lipid?

Biology
1 answer:
zhenek [66]3 years ago
7 0
Water is



Water is a Liquid
You might be interested in
a fluid bathes every cell in the body and provide a medium of exchange between the cells and blood capillaries. All the followin
JulsSmile [24]
Options are:
a) lymph. 
b) interstitial fluid. 
c) extracellular fluid (ECF). 
d) plasma.

All the following are correct terms for this fluid except lymph. 

The interstitial fluid surrounds the cells in the body. The other major component of the ECF is the intravascular fluid of the circulatory system called blood plasma. Whereas, Lymph is a fluid which contains infection-fighting white blood cells, throughout the body.
6 0
3 years ago
What is the first phase of mitosis
agasfer [191]
It is Prophase.

Hoped this helped.

~Bob Ross®
4 0
3 years ago
Water can seep into rocks and dissolve minerals. The dissolved minerals can be washed away. What type of weathering is this? Exp
aliya0001 [1]
Any process that exerts a stress on a rock that eventually causes it to break into smaller fragments is a type of mechanical weathering. 
3 0
3 years ago
Read 2 more answers
1. Explain how dehydration synthesis and<br> hydrolysis are related.
PolarNik [594]

<em>Answer: In dehydration synthesis reactions, a water molecule is formed as a result of generating a covalent bond between two monomeric components in a larger polymer. In hydrolysis reactions, a water molecule is consumed as a result of breaking the covalent bond holding together two components of a polymer.</em>

3 0
3 years ago
Give an example of a nontestable question:
nekit [7.7K]

Answer:

What is the best brand of soda?

Explanation:

Everyone has their own opinion on best brands of soda.

8 0
2 years ago
Other questions:
  • True or False A parasite having no intermediate host is liverfluke.
    11·1 answer
  • All wetlands are considered freshwater ecosystems.   Please select the best answer from the choices provided T F
    9·1 answer
  • Prairie dogs are burrowing rodents that live in grasslands. What makes the prairie dog a keystone species in the ecosystem?
    14·2 answers
  • In pea plants, the allele for tallness (T) is dominant over the allele for shortness (t). If two tall pea plants are crossed, ca
    5·1 answer
  • ​which substance is known to be produced by small intestinal bacteria?
    6·1 answer
  • In order to change C to B to A, one would need to:
    10·1 answer
  • 95% of plastics in the ocean are
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Tell me more about the parts of the water cycle and how they work.
    14·1 answer
  • Any answers? Very confused.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!