1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha2012 [34]
3 years ago
10

8

Biology
1 answer:
ikadub [295]3 years ago
7 0
It will spontaneously decay into other stable elements
You might be interested in
To help you remember the processes that enable cells to live, you will be using the processes to write a story. You will be writ
IRINA_888 [86]

Answer:

hello

Explanation:

3 0
2 years ago
GET 10PTS EACH true testing means that a serious effort is made to _________.
allochka39001 [22]

Answer:

running back the other two are not as easy to make surely that's they're justified dont gets its taken themselves too getting too they point of the question of how much money they have in their own

4 0
3 years ago
Read 2 more answers
Which conditions relate to the research of van Helmont
Blababa [14]
Plant mass that is related to H20.
7 0
3 years ago
Read 2 more answers
PLEASE HELP !!!! I give lots of points !!!!
jonny [76]
The answer to the question is 2
8 0
3 years ago
Read 2 more answers
Explain one reason why the study of climate change has become so complex.
Ahat [919]

Cause now afays climate changes very fast and more technologies hot advanced

4 0
3 years ago
Other questions:
  • Which of the following is a layer of the solid Earth?
    15·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following is characteristic of a parallel circuit?
    11·2 answers
  • Which​ moist-heat cooking method is associated with foods that need to be tenderized through​ long, slow, moist​ cooking, such a
    10·1 answer
  • Decide whether each characteristic is true of the Māori myth, the Haida myth, or both.
    13·1 answer
  • The cytric acid cycle requires the presence of _____ for completion
    10·1 answer
  • What is the purpose of the part of the female reproductive system highlighted
    5·2 answers
  • !!!!!!!WILL MARK BRAINLIEST!!!!!!!!!A sudden increase in activity level can cause stress fractures.
    15·1 answer
  • What is cytoplasm?<br>good evening ​
    10·1 answer
  • (opening the door) describe the work of at least 3 body organ Systems that work during the process.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!