1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna35 [415]
3 years ago
14

Description of milking machine​

Biology
1 answer:
Taya2010 [7]3 years ago
4 0

Answer:a nearly automatic machine installation for milking cows

You might be interested in
PLEASE HELP MEE
romanna [79]
A bison and elk

i think
5 0
3 years ago
Read 2 more answers
Why is it significant that all biological systems use l-amino acids and d-sugars?
-Dominant- [34]
<span>L-amino acids and D-sugars are part of every protein.
All proteins are made up of them.
The fact that all biological systems use L-amino acids and D-sugars is linked with the idea that certain groups of organisms come from a common ancestor because. The reason is that if the common ancestors used L-amino acids and D-sugars, than its offsprings use them as well.

</span>
8 0
3 years ago
What feature would you expect to find in a population in which sexual selection depends on female choice?
Paraphin [41]

Answer:brightly colored males

Explanation: for apex

7 0
3 years ago
Read 2 more answers
Hello people ~
gulaghasi [49]

Explanation:

\longmapsto\: \purple{ \underline{ \boxed{\frak{ hell o \: mate }}}}

Seed formation without fertilization in flowering plants involves the process of ---

A) APOMIXIS

4 0
2 years ago
Read 2 more answers
The kilogram (kg) is a measurement of which quantities?
Artemon [7]

Answer:

basic unit of mass

Explanation:

A kilogram is very nearly equal (it was originally intended to be exactly equal) to the mass of 1,000 cubic cm of water. The pound is defined as equal to 0.45359237 kg, exactly.

4 0
3 years ago
Other questions:
  • Over time, color variation in a population of butterflies declined. The number of color variations within the population was twe
    6·2 answers
  • How many kilometers has each ocean basin opened in the past 2 million years
    13·1 answer
  • 3.a group of tissues that work together to perform a similar function. A.cell B.organelle C. molecule D.organ
    14·2 answers
  • Increasing the frequency of stimulation so that a muscle contracts without relaxation is called
    5·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • What equals to 12 g into mg and 12 grams into ng? <br><br> Same for the second question?
    12·1 answer
  • Which of the following best describes the main purpose of the sequences of nitrogenous bases in DNA? *
    14·1 answer
  • 5. In humans, the gene for brown eyes is dominant over the gene for blue eyes. If two parents, both
    11·1 answer
  • Any animal eaten by a predator could be classified as:
    10·1 answer
  • Who's more likely to survive a bullet wound; a body builder or an obese person?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!