1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksian1 [2.3K]
3 years ago
14

Help me is easy ❤️❤️❤️

Biology
2 answers:
Butoxors [25]3 years ago
8 0

Answer:

the answer is ribosomes

Explanation:

this is because when mature mRNA molecules leaves the nucleus to the cytoplasm the ribosomes are also located there

bonufazy [111]3 years ago
7 0

Answer:

A. Ribosomes translation occurs

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which of the following is true for a water molecule
MArishka [77]

Answer:

The oxygen atoms have electrons more often than hydrogen.

Explanation:

5 0
3 years ago
Read 2 more answers
Abiotic factors in the environment are all _________. A. Easily measured B. Living C. The same as the dead things D. Non living
Ede4ka [16]

Answer:

the answer is d. non living

8 0
3 years ago
If you have the frequency of the recessive allele for a gene, how do you get the
Nastasia [14]
B. subtract the frequency of the recessive allele from 1.
8 0
3 years ago
Certain mental problems are thought to be caused by not having enough neutrotransmitters why would a lack of neurotransmitters c
vekshin1

Because neurones will not function properly neither will neuroreceptors if a person lacks neurotransmitters, these two parts (transmiters and receptors) all work together and depend on eachother.

Neurones are resposible for transmitting informations trought the body, and if neurotransmitters are no-existent, information may not be able to get to some body parts since neurotransmitters transmit the information.

Hope it helped,

Happy homework/ study/ exam!

3 0
3 years ago
Read 2 more answers
Other questions:
  • The acronym that stands for habitat destruction, invasive species, pollution, human population, and overharvesting is
    13·1 answer
  • What is primary succession?
    8·2 answers
  • What are the estimated allele frequencies in a population if the frequency of the dominant phenotype is 0.64 (Hint: handout to g
    12·1 answer
  • Write 1 to 2 paragraphs explaining the role chromosomes play in heredity. Include the structure and function of chromosomes.
    11·2 answers
  • In his theory of natural selection, Darwin incorporated the premise that available resources were not sufficient for all members
    9·1 answer
  • A polygenic trait is contributed by two or more genes one gene two alleles multiple alleles
    10·2 answers
  • How many years does succession take
    8·2 answers
  • Which of the following is an abiotic factor in the environment?
    6·1 answer
  • Which process or occurrence removes carbon from the atmosphere.
    13·1 answer
  • What is Random error in science ?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!