1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marysya12 [62]
2 years ago
15

The fertilization of an oocyte by more than one spermatozoon which results in embryo death is known as

Biology
1 answer:
Rama09 [41]2 years ago
5 0

Answer:

Monospermy and Physiological Polyspermy. In general, the entry of more than two spermatozoa into the egg cytoplasm, referred to as polyspermy, causes aberrant effects on meiosis completion or embryo development and hence embryonic death, due mainly to excess male centrosomes delivered into the egg.

Explanation:

You might be interested in
____ means finding a locations based on its distance from three other locations
tekilochka [14]

It's either longitude or absolute location. Sorry if these aren't correct.

8 0
3 years ago
To prevent burglaries, your house door should remain<br> at all times.<br> locked<br> unlocked
DENIUS [597]
To prevent a burglary your house should be remained locked when you are away.
8 0
4 years ago
Read 2 more answers
Form a hypothesis about how the loss of estuaries can increase erosion along shorelines<br>​
lakkis [162]

Answer:

The hypothesis can be made as follows:

' If there are less or no estuaries in a river, then there will be more erosion at the shorelines.'

A hypothesis is a tentative statement which can either be supported through experiments or proven to be wrong.

In the following scenario, we can conduct experiments by taking into observation those rivers which have estuaries and those which do not have estuaries. We can then compare the erosion of the shorelines of the rivers to validate our hypothesis.

3 0
3 years ago
What are types of scientific explanation​
vagabundo [1.1K]

Answer:

theories, models, and laws

Explanation:

5 0
3 years ago
What are the general roles of carbohydrates
11111nata11111 [884]

Answer: One of the primary functions of carbohydrates is to provide your body with energy.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • What is the medical term for infection of the urinary bladder?
    7·1 answer
  • Because of the large heat of __________ of water, the evaporation from a liquid surface is a very effective cooling mechanism. T
    10·2 answers
  • What is that balanced?
    12·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which is more efficient in terms of producing ATP from glucose?
    14·1 answer
  • Which category of environmental worldview do you think would be most likely to lead to a sustainable future if it were widely ac
    15·1 answer
  • Which of the following processes occurs when nuclei begin to surround the chromosomes on either end of the pole during meiosis I
    8·1 answer
  • Difference between olfactory nerve and auditory nerve​
    8·1 answer
  • Model of a cell cycle
    6·2 answers
  • Which agency recommends that all pregnant women should be screened for common infections and treated if infected?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!