1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlada [557]
3 years ago
6

The closing on your ad gives details about your services. True False

Biology
1 answer:
kykrilka [37]3 years ago
7 0

Answer:

True

Explanation:

In the closing, often a brief explanation is given on the company's name what they do how u can contact them and maybe some other information

P.s I do not take this subject

You might be interested in
In a population of weasels, black (R) is the dominant color and white (W) is the other dominant trait. In weasels, fur color fol
ivolga24 [154]
Well, you don't specify the parent traits, so I'll just do one for each...

If both parents are homozygous RR, then all 60 of the babies will be black

If both parents are homozygous WW, then all 60 of the babies will be white 

If both parents are heterozygous RW, then there will be 15 black babies, 15 white babies, and 30 spotted babies. 

If one parent is homozygous RR and one is homozygous WW, then all of the babies will be spotted

If one parent is homozygous RR and one is heterozygous RW, then 30 of the babies will be black, and 30 will be spotted

If one parent is homozygous WW and one is heterozygous RW, then 30 of the babies will be white, and 30 will be spotted. 
4 0
3 years ago
Read 2 more answers
Please I need help with questions 62 and 64 and it’s very hard and I’m struggling with it and if you need to see the picture big
slega [8]
62 -- The roots absorb water for the plant, and also provide it with stability, ie to keep it from falling over.64 -- Structure B is a leaf, and a leaf's main function is to take in sunlight and perform photosynthesis, which makes food for the plant.

5 0
3 years ago
A local widening of an artery which may be life threatening is a/an
Maru [420]
Hey there,
The answer is - aneurysm<span>
Hope this helps :))

<em />~<em>Top♥</em>
</span>
8 0
4 years ago
A cell is unable to synthesize proteins. What most likely caused this?
fenix001 [56]

Answer:

c

Explanation:

ribosomes are used to synthesize proteins in cell. When it had been destroyed, the cell won't get proteins

5 0
3 years ago
Read 2 more answers
If bicoid mRNA is injected at the anterior end of an egg from a bicoid mutant mother, what would the phenotype of the resulting
JulijaS [17]

If the larva had one head at the posterior pole, it would be normal. The larva would have two heads, one at the front of its body and the other in the center.

What is bicoid mRNA?

When translated, bicoid protein forms a morphogen gradient that shapes the embryo's head and thorax if bicoid mRNA localizes to the anterior of the Drosophila egg.

How does the egg's bicoid RNA influence development?

According to recent research, Bicoid specifies the anterior of the Drosophila embryo in two different ways. It initially suppresses posterior development. It accomplishes this by attaching to and preventing caudal RNA, which is distributed throughout the egg and early embryo, from being translated.

To know more about bicoid mRNA, visit:

brainly.com/question/15864503

#SPJ4

7 0
1 year ago
Other questions:
  • The diagram shown above, illustrates the _______ cycle.
    9·1 answer
  • The root of a flowering plant absorbs water and mineral ions mainly through:__________A. the epidermisB. the root hairsC. the ph
    13·1 answer
  • Is the structure of dna related to its function
    15·1 answer
  • Which type of protein is the best? Why?
    12·1 answer
  • Tail length in mice varies within a population. Scientists observed change in the distribution of tail lengths in a mouse popula
    15·1 answer
  • Erythrocytes are an example of specialized cells <br> true<br> false
    10·2 answers
  • Elements 2 &amp; 3 are major building blocks in glucose, fructose, and sucrose. What are these elements?
    8·2 answers
  • Why does acid precipitation weather rocks faster than normal precipitation does?
    15·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • How is mitochondrial DNA (mtDNA) typing used in forensic science?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!