The protein encoded by the mutant allele is shorter than the one encoded by the normal allele, the protein encoded by the mutant allele could be non-functional and the mutant allele could be associated with disease. In addition, DNA and mutation can happen possibly wherever on these molecules at any time. The most severe variations take place in the useful units of DNA is the genes in which the mutated form of a gene is named a mutant allele.
The air spaces occur in Spongy mesophyll tissue.There are large spaces in a leaf because it is for storing water and carbon dioxide which will be used for photosynthesis. The large air spaces are usually found in the spongy layer of the mesophyll. The arrangement of this spongy mesophyll facilitates the movement of gases through the mesophyll. Directly beneath each stomate at the leaf surface there is usually a small air space, called a stomatal chamber, where no mesophyll cells are present. This also aids in gas exchange.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
It is threatening the Arctic Tundra Biomes By Melting The Ice....Love
The answer would be C. studying chromosomal changes in mitosis cell division. because mitosis is when the parent cells are just copies of an identical cell or known as the daughter cell.
