1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
12

Read public problems in US society, do you think the benefits created through public programs outweigh their expenses?

Biology
1 answer:
SVETLANKA909090 [29]3 years ago
6 0

Answer:

Read public problems in US society, do you think the benefits created through public programs outweigh their expense

Explanation:

Read public problems in US society, do you think the benefits created through public programs outweigh their expense

You might be interested in
. Which characteristic of prokaryote makes them different from eukaryotes?
lawyer [7]

Answer:

its dna structure make prokaryote different from eukaryotes

7 0
2 years ago
Read 2 more answers
How are proteins and nerve cells interrelated?​
allochka39001 [22]

Answer:

The answer to Your Question Is down below :)

Explanation:

Working with mice, scientists have discovered that a particular protein helps nerve cells extend themselves along the spinal cord during mammalian development.

8 0
3 years ago
HELP PLEASE WILL GIVE BRAINLY! <br><br> What is a complementary RNA strand to AGA?
Irina18 [472]

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

5 0
3 years ago
Question one please and maybe the rest? Giving plenty of points.
lys-0071 [83]
A) no. the man can’t be a carrier

b) his father

c) no. the colorblindness has to show up on both X and Y chromosomes to be colorblind. So if the mother is not colorblind nor a carrier, then most likely it won’t happen since it’s a recessive gene.
6 0
3 years ago
If a woman with curly hair and a man with straight hair have a child with wavy hair, the gene for this characteristic of hair sh
Stells [14]

Answer:

The correct option is Incomplete dominance.

Explanation:

Incomplete dominance describes the situation in which the phenotype of heterozygous is different from that of their respective homozygous. It means that when both parents are homozygous for some feature, each expressing a particular phenotype, their heterozygous descendants have a phenotype that will be between the phenotypes of their parents. In the present case, the woman has curly hair ( dominant homozygous) and the man has straight hair (recessive homozygous), but the child have wavy hair (heterozygous), not curly nor straight.

7 0
3 years ago
Read 2 more answers
Other questions:
  • A simplified representation of an object, structure, or system used in analysis, explanation, interpretation, or design is calle
    12·2 answers
  • These are evolutionary changes within a species or small group of organisms, especially over a short period of time.
    8·1 answer
  • What happens during fertilization?
    6·1 answer
  • Two aligned sequences fo the same gene differ by four substitutions, all transitions, two more sequences for the same gene also
    12·1 answer
  • An interaction between two organisms in which one usually benefits is known as <br> .
    11·1 answer
  • 20 POINTS!! How does a DNA molecule make a copy of itself?
    13·2 answers
  • The membrane that covers the outer surface of the eye and lines the eyelids is the ________.
    15·1 answer
  • Here is the youngest crust on Earth most likely located?
    5·2 answers
  • Is this right ? I need to know it’s due at 10:30
    5·1 answer
  • In which biome do herds of caribou and reindeer migrate in and out? A. tropical rainforest B. desert C. Mediterranean/chaparral
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!