Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
It is c. Unlike a eukaryotic cell, the cell wall helps the plant cell from bursting from all the water that is consumed.
Hoped this helped.
~Bob Ross®
Answer:
DNA is made up of a double helix of two complementary strands. During replication, these strands are separated. ... Most prominently, DNA polymerase synthesizes the new strands by adding nucleotides that complement each (template) strand. DNA replication occurs during the S-stage of interphase.
Explanation:
Answer:
1. Noncompliance
2. Fraud
3. Ethics
4. Morality
5. Integrity
6. Bias
Explanation:
Hope this helps : ) they are very similar and quite tricky but I found this was the best fit.
Answer:
jozbzjx
Explanation:
bsjdidvxyiz8xxgs8evee7eyes
