1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
3 years ago
15

7)When a body cell divides through the process of mitosis, the chromosomes in the daughter cells *

Biology
1 answer:
nexus9112 [7]3 years ago
7 0

Through the mitotic process, two identical diploid daughter cells are produced. Mitosis is preceeded by the interphase and followed by cytokinesis. 7) b. / 8) a. / 9) b. / 10) b. / 11) c. / 12) a.

-------------------------------------------------

The interphase occurs before cell division. It is composed of the G1, S, and G2 stages.

  • During the G1 stage, the cell duplicates in size. The organelles and other cytoplasmatic structures duplicate. The high intense biochemical activity is characteristic of this stage.

  • During the S stage occurs the DNI molecule replication process. At this point, also happens the synthesis of histones and other associated proteins.  

  • The G2 stage is the final one before the cellular division. Here begins the slow process of DNI condensation. Duplication of centrioles completes. Structures such as spindle fibers are assembled.  

Mitosis is a process by which, from a diploid somatic cell (2n), two daughter diploid cells (2n) are produced.  

Daughter cells are identical to the original cell.

Mitosis occurs in only one phase, divided into four stages.

  • In the prophase, it occurs chromosomes condensation and nuclear membrane breaks.

  • During the metaphase, chromosomes are taken toward the center of the cell by the spindle apparatus. Once in the equatorial plane, chromosomes line up.

Each chromatid joins with a microtubule of opposites poles.

  • In Anaphase, bonds between chromatids break. They separate and migrate to the opposite poles.

  • In telophase, duplicated chromosomes are already in the corresponding poles, and the nuclear membrane forms again in each pole.  

Finally, cytokinesis occurs.

                                       *************************************

Now, according to this theoretical framework, we can answer the questions.

7) b. <em>are identical to the chromosomes of the parent cell.</em>

8) a. <em>The information is duplicated.</em>

9) b. <em>Mitosis is a phase in asexual reproduction that results in the formation of identical nuclei in the daughter cells.</em>

10) b. <em>I and III only</em>

11) c. <em>The cell's DNA is replicated.</em>

12) a. <em>Certain genes are turned on and others are turned off; this action produces adult cells that are specialized</em>

<em />

<em>----------------------------------</em>

<em />

Related link: brainly.com/question/538483?referrer=searchResults

                     brainly.com/question/20223797?referrer=searchResults  

                     brainly.com/question/10606931?referrer=searchResults

                     brainly.com/question/1983951?referrer=searchResults

                     

You might be interested in
Earthworms have a(n) , birds have a(n) , and spiders have a(n) . Endo exo or hydroskeleton these choices are used for all three
dezoksy [38]
<span>The types of skeleton depend on where they are located. Earthworms have hydroskeleton because their rigid bodies are based on water pressure so it's hydro then. Endo is found in animals like birds and also humans who have it inside. Exo is found in spiders because they are bugs and bugs have their skeletons like a shell that covers them.</span>
8 0
3 years ago
Read 2 more answers
Select the pituitary hormone that increases the concentration of blood sugar A. cortisol B. growth hormone C. glucagon AND. epin
marissa [1.9K]
The tragus is a small pointed eminence of the external ear, situated in front of the concha, and projecting backward over the meatus. It also is the name of hair growing at the entrance of the ear.
7 0
2 years ago
Explain why the father determines the gender of a child
vaieri [72.5K]
Both men and women have sex chromosomes. Men usually have one X and one Y chromosome, while women have two X's.

When an egg or sperm is made, it only gets one of the sex chromosomes from the parent. This means that women can only make eggs with an X chromosome. But men can make either X or Y sperm.

During fertilization, the sperm cells race toward the mother-to-be's egg cell. If a sperm with a Y beats all others, then the fetus will be XY. The pregnancy will result in a boy.

However, if a sperm with an X wins the race to the egg, then the fetus will be XX. The parents will have a baby girl.

Nearly everyone's chances are around 50% for having a boy and 50% for having a girl. And yet, we all know families that are all boys or all girls.
6 0
4 years ago
Read 2 more answers
What type of chemical bonds would expect to find in ionic compounds ?
Natali [406]

Answer:

It is a type of chemical bond that generates two oppositely charged ions. In ionic bonds, the metal loses electrons to become a positively charged cation, whereas the nonmetal accepts those electrons to become a negatively charged anion.

Explanation:

8 0
3 years ago
I will mark brainlyest
SashulF [63]

Answer:

a b e

Explanation:

these are all pros of living in groups

7 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Thermal energy travels through space from the sun to the venus. this is an example of
    10·1 answer
  • The most likely reason there are few large trees in the tundra is because
    6·1 answer
  • What is the neurotransmitter released at motor end plates by the axon terminals
    8·1 answer
  • Why are coal, natural gas, and oil non renewable resources ?
    10·1 answer
  • When you run an electrical current through liquid water, the water molecules are split apart to form oxygen and hydrogen gas.
    11·1 answer
  • As a scientist, you seek to prove that DNA is the hereditary macromolecule by replicating the Hershey-Chase experiment. You cult
    11·1 answer
  • Which statement best describes Earth’s outer layer underneath the surface in the image?
    9·2 answers
  • Help me!!!! Please I have been stuck on this for like 1 hour.
    7·1 answer
  • What’s a convection current and how is it caused?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!