1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notsponge [240]
2 years ago
13

Distinguish between uric acid, urea and ammonia​

Biology
1 answer:
Semenov [28]2 years ago
8 0

Answer:

Explanation:

Ammonia is associated with aquatic animals; urea is associated with most terrestrial and semiterrestrial vertebrates, but rarely land invertebrates (Campbell et al., 1972); and uric acid is the major product of terrestrial invertebrates, birds and reptiles (Prosser & Brown, 1961).

You might be interested in
What type of reaction is shown below?
Bess [88]

Answer:

D

Explanation:

4 0
2 years ago
Help science!
dimulka [17.4K]
The answer is vehicle fuel
8 0
3 years ago
1) In 1783 Antoine Lavoisier showed that the heat produced by respiration was comparable to the heat produced when charcoal was
tankabanditka [31]
The correct answer is B combustion.

Lavoisier’s oxygen theory of combustion was one of his most notable contribution to science and earned him the title of the “father of modern chemistry”. He recognized the combustible property of oxygen and that phosphorus and other metallic elements increased in terms of weight when burned.  
7 0
2 years ago
Read 2 more answers
why is it impossible for hikers camping near the top of a 14000 foot peak to get a really hot cup if coffee
Law Incorporation [45]
Because the oxygen level is lower
3 0
3 years ago
Varying the enzyme- For a one-substrate, enzyme –catalyzed reaction, double –reciprocal plots were determined for three differen
zmey [24]

Answer:

answer is in the image below.

Explanation:

4 0
2 years ago
Other questions:
  • An instructor had her students perform this laboratory beginning with setting up their own restriction enzyme digests. One team
    14·1 answer
  • Which type of star will become a black hole when it dies?
    14·2 answers
  • Which of the following is a need of most plants? A. To release carbon dioxide to the environment. B. To take up oxygen from the
    8·1 answer
  • The active ingredient in the conversion of organic material into alcohol is
    7·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Beginning from the bottom of the strand what would be the amino acid sequence? A. Leu-stop-Arg-Leu B. Glu-Thr-Ala-Asn C. Leu-sto
    9·1 answer
  • This is the amino acid cysteine. Circle the amine group, put a box around
    14·1 answer
  • Suppose you are involved in a project studying a population of Dalea purpurea (purple prairie clover), a diploid, bee pollinated
    12·1 answer
  • Sponges have flagellated cells called _____ that line their internal chambers and create water flow to capture food
    5·2 answers
  • From a trough to a peak, the economy goes through
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!