1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natita [175]
3 years ago
5

Jeremy has parkinson's disease, a progressive neurodegenerative disease that affects motor skills. in addition to motor symptoms

, jeremy has noticed changes in his mood, and he feels the need to smoke more cigarettes than he used to. it is likely that jeremy's brain is producing less ________ than it needs to.
Biology
1 answer:
vaieri [72.5K]3 years ago
7 0
<span>Jeremy has change in his moods ad wanted to smoke than usual in addition to Parkinson disease, this may be because his brain is producing less acetylcholine than it suppose to. This is the reason he is lacking certain planning and control of actions and is disoriented.</span>
You might be interested in
A marine biologist and her team capture 56 sea turtles and mark them before releasing them. The following year, they capture 45
Vadim26 [7]

Answer:

B

Explanation:

5 0
2 years ago
Read 2 more answers
1)
Molodets [167]

D) Thorns are an adaptation that some plants have evolved in order to discourage herbivores from eating the plant.

3 0
3 years ago
Read 2 more answers
What are the benefits that humans receive from the ecosystems called?
11111nata11111 [884]
A is your answer u welcome
6 0
3 years ago
A dichotomous key is a _____. 3 choice key 1 choice key 4 choice key 2 choice key
PilotLPTM [1.2K]
A dichotomous key is a 2 choice key. I believe this is the solution.
4 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
2 years ago
Other questions:
  • 2x+y=−8x−y=−4{2x+y=−8x−y=−4
    6·1 answer
  • Using the above set-up what is the phenotypic ratio of the offspring of this cross?
    10·1 answer
  • Platooooooooooooooooooo
    12·1 answer
  • Which type of molecule contains the alcohol glycerol? which type of molecule contains the alcohol glycerol? carbohydrate phospho
    10·1 answer
  • QUICK BRAINLEST PLEASE! I is a easy question... I just don't know it.
    14·1 answer
  • Why is DNA important to a cell?
    12·2 answers
  • Stromatolites are rocky structures that generally form in shallow waters from the binding of sediment by microbial biofilms. Str
    7·1 answer
  • How does hibernation help bears survive? I need this for a science grade.
    10·2 answers
  • Based on the graph, the half-life of this radioactive isotope is ​
    15·1 answer
  • From a trough to a peak, the economy goes through
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!