1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreyy89
3 years ago
7

Which substance should have the highest pH? distilled water lemon juice bathroom cleaner vinegar

Biology
1 answer:
dimulka [17.4K]3 years ago
8 0
Bathroom cleaner would have the highest pH because it is an alkaline substance (pH more than 7) whereas distilled water is around pH 7 and lemon juice and vinegar are acids (pH less than 7).

Hope this helps!
You might be interested in
_____ act as signals or markers to help cells recognize one another.
Varvara68 [4.7K]

Explanation:

-<u>Carbohydrates </u>act as signals or markers to help cells recognize one another.

Carbohydrates are organic macromolecules with a range of functions within organisms. They may act as energy storage, structural support, and signal molecules. Together with transmembrane proteins embedded within the membrane from the extracellular fluid to the cytoplasm, they form glycoproteins (proteins attached to carbohydrates) which function as cell surface markers .

 

Further Explanation:

Carbon, is the backbone of all biological life on Earth. It contains 6 electrons, with 4 on its valence shell, and thus, readily forms covalent bonds with other elements. Covalent bonding involves the sharing of electrons; in nature, this occurs with hydrogen,oxygen, nitrogen, and phosphorus as highly flexible single bonds capable of rotation; rigid, non-rotating  double; and very strong triple bonds. Carbon compounds form rings, and long branched chains- thus, carbon can form macromolecules in nature.

In nature, organic compounds may be large chains of monomers form biological macromolecules which carry out many essential functions in the body. These can include nucleic acids, carbohydrates, proteins and lipids. These are organic molecules, meaning they're ringed or long-chain Carbons bonded to the elements oxygen (O), hydrogen (H), nitrogen (N) and phosphorus (P); they are found in essential organic biomolecules include, proteins, nucleic acids, lipids and carbohydrates.

Carbohydrates function to supply energy and support molecules they consist of mainly sugars or starches in long chains and rings to form monosaccharide monomers. They include monosaccharides, disaccharides and polysaccharides which describes the type of bonding and the degree of complexity of the polymers. Basic makeup: C, H, O -with many polar OH groups

Learn more on  proteins and carbohydrates at brainly.com/question/10744528

Learn more on membrane components at brainly.com/question/1971706

#LearnWithBrainly

3 0
4 years ago
The effect of malonic acid on the activity of succincte dehydrogenase suggests which of the following
butalik [34]

Answer:

Hmmmm u need to us your head its e zzz zzz zzz if u try

6 0
3 years ago
As a baby, Gina was exposed to a pathogen. Because of passive immunity, Gina's body was able to fight off the pathogen before sh
Serhud [2]

First of all, it is important to understand the difference between passive and active immunity.

Passive immunity is when we are given antibodies that were not produced by our own body (for example those transferred from mother to child, or those taken as part of medication or therapy - note that the former would be an example of naturally acquired passive immunity and the latter of artificially acquired passive immunity).

Active immunity, on the other hand, refers to antibodies that were produced by our own bodies due to exposure to a pathogen or part thereof - this can also be naturally acquired, such as when we are infected by a pathogen, or artificially, such as when we are vaccinated.

Given this information, what enabled Gina to fight the pathogen would be the second answer (antibodies she received from her mother), however we can also look at the other answers and discount them as false to be sure:

Answer 1 - high fever caused by a pathogen

The question states that Gina was able to fight off the pathogen before she got sick - a fever suggests that:

a) she is already sick

b) her body is launching its own immune response

Answer 3 - antibodies she received from a vaccination

The antibodies produced as a result of vaccination are produced by your own body (despite being stimulated artificially through exposure to the pathogen), thus this is not the correct answer.

Answer 4: inflammation caused by antibodies

This answer is incorrect due to the fact that antibodies do not directly cause inflammation.

Thus, the correct answer is the second one 'antibodies she received from her mother'.

Hope that helps :)

3 0
4 years ago
Read 2 more answers
Please help it’s urgent!!!!
mina [271]

Answer:

True

Hope this helps :)

3 0
3 years ago
13C and 14C are isotopes of 12C, which has 6 electrons, 6 protons, and 6 neutrons. What is the arrangement of subatomic particle
Phantasy [73]
I believe the answer is C. 6 electrons, 6 protons, and 8. neutrons
6 0
2 years ago
Read 2 more answers
Other questions:
  • Why is science boring?
    14·2 answers
  • What are ligaments and what are the characteristics about them?
    11·1 answer
  • What type of mutations will potentially be passed to offspring?
    11·2 answers
  • Alternative energy sources like solar and wind power _______.
    7·2 answers
  • 20 POINTS PLEASE HELP
    14·1 answer
  • Which of the following is am example of adaptive radiation?
    12·2 answers
  • Why is the transfer of energy in a food chain usually only about 10 percent efficient?
    6·1 answer
  • What is the angle of rotation for a point on a circle for drawing an equilateral triangle
    14·1 answer
  • Vitamin B and folic acid deficiencies are characterized by production of abnormally large erythrocytes called
    10·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!