1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nady [450]
2 years ago
9

Hey guys who needs gf I am lonely​

Biology
2 answers:
zhenek [66]2 years ago
5 0

an echo when the same with us and we can use the form of the cardboard box of light and plural form of the cardboard box of light and plural form of the cardboard box of light and plural form of the cardboard box of light and plural form of the cardboard box of light and plural form of the cardboard box of light and plural form

horsena [70]2 years ago
5 0

Answer:

You're asking for yourself to get banned.

No

Explanation:

#Nova

You might be interested in
Pls help. Plant cell
Soloha48 [4]

Answer:

B and D (the 4th answer)

Explanation:

5 0
2 years ago
Look at the map above. what type of weather is the northwest having?
MA_775_DIABLO [31]
Cold front


If you don’t know the compass, just go by Never Eat Soggy Waffles

North East South West
4 0
3 years ago
The stage of infection from the time a pathogen enters your body until symptoms appear is known as the _______________ stage.
Sophie [7]
Incubation stage is the stage where the prepares and begins a full on assault of your body.
6 0
3 years ago
Help please!!!!!!!! Its integrated science ​
iVinArrow [24]

Answer:

True

Explanation:

6 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which one of the following is considered a cause of the current mass extinction?
    13·2 answers
  • Define purebred using both terms genotype and allele.
    5·1 answer
  • Adenosine triphosphate atp is important because it
    10·1 answer
  • Articular cartilage of a long bone is found Select one: a. on the outer surface of the epiphyses. b. inside the medullary cavity
    8·1 answer
  • What conclusion is best supported by the selection above ? NUMBER 2
    12·1 answer
  • The annual world seafood catch grew from approximately 19 million tons in 1950 to approximately 90 million tons in 1997. As a co
    6·2 answers
  • Food moves through the digestive system in a series of waves of muscular contractions called ______________.
    5·1 answer
  • How does negative feedback mechanism work in osmoregulation
    14·1 answer
  • Please help! ASAP AND THANK YOU!
    8·1 answer
  • Some bacteria are aerobic and others are anaerobic. What does this mean?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!