1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aloiza [94]
3 years ago
15

True or False: A Mutation is something that ONLY affects a chromosome, not the DNA.

Biology
2 answers:
egoroff_w [7]3 years ago
6 0

Answer:

I want to say B. False

Explanation:

mestny [16]3 years ago
3 0

Answer:

I am pretty sure it is B..........

You might be interested in
Being able to understand and follow rules is an example of _<br> __skills.
ivanzaharov [21]

Answer:

how many letters are there before skills?

Explanation:

If there is two spaces then i have the wrong answer

5 0
3 years ago
Patent fingerprints, or visible fingerprints, are left on a smooth surface when blood, ink, or some other liquid comes in contac
lana [24]

Answer:

Answer is option A (True).

Explanation:

The fingerprint pattern of an individual is unique as no two individuals have the same pattern and it remains unchanged. So fingerprints are considered as one of the main types of physical evidence that can be recovered from a crime scene for identification purposes.

The three types of fingerprint impressions are;

Patent fingerprints or visible fingerprints - They are visible prints that are left on a smooth surface of another object when foreign substances such as blood, ink, or some other liquid present on the skin of a finger come in contact with the surface. These prints are easily identifiable and are visible with the naked eye without any technological enhancements.

Plastic prints - They are visible, three-dimensional prints that are left on soft surfaces such as freshly painted surfaces or materials like wax, gum, clay, soap, etc when a finger comes in contact with that surface resulting in an indentation. These prints are easily observable and no enhancement is required.

Latent prints - They are invisible fingerprint impressions that are left on a surface as a result of the perspiration, moisture or oil found in the ridges of fingers. Since they are not visible to the naked eye, enhancement is required upon their collection.

8 0
2 years ago
Fertilizers are used to replenish what in the soil?
hodyreva [135]

Answer:

d

Explanation:

5 0
2 years ago
Read 2 more answers
What is the significance of extra atmospheric carbon dioxide in the earths earth's atmosphere
maw [93]

Answer:

Extra Carbon Dioxide in the atmosphere increases the temperature on Earth.

Explanation:

Carbon Dioxide is a greenhouse gas so when there is increasing Carbon Dioxide we see the greenhouse effect.

8 0
2 years ago
The river is polluted with nutrients, causing algae populations to grow out of control. Why
Rama09 [41]

The bloom in the population of algae might negatively affect the ecosystem because big changes to the population of one organism in an ecosystem could affect other organisms.

<h3>Effects of population change</h3>

A sudden increase in the population of a species in an ecosystem could affect the population of other species in ways we could not even imagine.

The population expansion could create several problems such as competition for space, nutrients, and even food. Another problem could be pollution.

More on the effects of population bloom can be found here: brainly.com/question/6458432

#SPJ1

8 0
1 year ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What type of organic molecule are enzymes? (proteins, lipids, carbohydrates, or nucleic acids)
    9·1 answer
  • What is one of the four elements that make up 96.3% of living cells
    15·2 answers
  • The partial displacement of a bone from its joint is known as
    6·1 answer
  • Why is the nucleus called the control center of the cell
    12·2 answers
  • How does sugar cross the cell membrane to get into a cell?
    15·1 answer
  • How do humans get energy from food?
    12·1 answer
  • 2. One characteristic of all living organisms is
    9·2 answers
  • What are some methods scientists have discovered that can stop a virus from spreading in its host? (Choose all that apply)
    13·1 answer
  • Mary and larry each have free earlobes and dark hair. they are both heterozygous. (e = free earlobes, e = attached earlobes, d =
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!