1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
2 years ago
10

What is the approximate carrying capacity of the population?In which year, did the population reach the carrying capacity?About

how many years did it stay at carrying capacity?
Biology
2 answers:
sp2606 [1]2 years ago
8 0

Answer:

Explanation:

Carrying capacity can be defined as a species' average population size in a particular habitat. The species population size is limited by environmental factors like adequate food, shelter, water, and mates. If these needs are not met, the population will decrease until the resource rebounds.The logistic population growth occurs when the growth rate of decreases as the population reaches the carrying capacity. The carrying capacity is the maximum number of individuals in a population that the environment can support.In ecological terms, carrying capacity is defined as the maximum number of a species that can sustainably live in a given area. In other words, a population's carrying capacity is the size at which a population can no longer grow due to lack of supporting resources.12-Dec-2013

Elanso [62]2 years ago
5 0

Answer:

1) 250 individuals

2) year 3

3) 4 years

Explanation:

Hope this helps:)

You might be interested in
Which of the following diseases primarily affects children?
grigory [225]
Possibly yellow fever can't confirm for sure
3 0
2 years ago
Read 2 more answers
Which parts of the scientific process differentiate it from pseudoscience? Check all that apply.
baherus [9]

Answer:

im pretty sure its 1 2 3 and 5

Explanation:

cause pseudoscience is based off nothing but feelings and opinion

5 0
2 years ago
Read 2 more answers
What’s the eighth planet from the sun ?
mr_godi [17]

Answer:

neptune

Explanation:

4 0
3 years ago
Read 2 more answers
What did Walter Sutton discover about the relationship between alleys and chromosomes?
cluponka [151]
Walter Sutton discovered that chromosomes are the basis of heredity and this explained the segregation of alleles in Mendel's law of segregation. Basically alleles and chromosomes in Mendel's explanation are the same thing.
4 0
3 years ago
Alma is planning on joining the track team this year. In preparation for the season, Alma decides she wants to start
anyanavicka [17]
This would have to do with aerobic and anerobic respiration
7 0
3 years ago
Other questions:
  • Descriptive relativism necessarily implies metaethical relativism.​ <br> a. True <br> b. False
    10·1 answer
  • The phenomenon where rare traits are found in abundance in a new or recently isolated location is called
    15·1 answer
  • Which of these mass movement events is considered
    15·2 answers
  • Explain why healthcare organizations might use military time for their records
    5·1 answer
  • 6. The breaking down and changing of rocks at or near Earth's surface is called
    13·2 answers
  • When magma reaches the surface of the earth, it is called​<br><br>plz help
    8·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • A 5th grade friend has seen a picture of your child and ask you to explain how kids get their traits from their parents. Using t
    10·1 answer
  • How many valence electrons does this atom have? How do you know?
    9·1 answer
  • Que tipos de musculos tiene el cuerpo humano? definir como se difencian?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!