1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kkurt [141]
3 years ago
13

Can you please help me

Biology
1 answer:
Kisachek [45]3 years ago
6 0

I am here to give the brainiest answer not to get points

Answer: yes

You might be interested in
Which mrna sequences would form a structure that is a cue for transcription termination of some genes?
torisob [31]

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

5 0
2 years ago
Which of the following are potential negative consequences of creating GMOs? (Pick more than one)
Oliga [24]

Answer: Introducing unintended diseases...

Creating problems scientists...

Permanently changing DNA...

7 0
3 years ago
Deforestation leads to environmental imbalance. Give reason.
vaieri [72.5K]

Answer: Well, deforestation is cutting down trees, and many arboreal animals live in those trees. So if they have no proper shelter, they would have no place for personal activities such as breeding, feeding etc. And without those important activities that they have to do everyday, the population of arboreal animals will keep on decreasing until they go extinct. Though that's not the only problem. The herbivores won't get anything to eat, hence not letting the omnivores or carnivores get their food. As you can see, deforestation can create a huge environmental imbalance.

5 0
3 years ago
Which of the following statements is true? A.)Tt and tt plants have the same phenotype. B.)A person with type O blood has two re
svetlana [45]

The correct answer is option B, that is, a person with type O blood has two recessive genes.  

An illustration of a trait determined by a single gene is blood type. Each human exhibits two copies of the gene for blood type on chromosome pair number 9. One of the copy is inherited from the father and the other one is inherited from the mother. An individual's blood type is determined by which allele he or she inherits from the parents.  

In case of blood type O, O is a recessive allele. If an A or B is inherited along with the O gene, the A or B gene decides the blood type of an individual. An individual is considered to have type O only if that person inherits two O genes, that is, a person with type O blood exhibits two recessive genes.  


3 0
4 years ago
10
Kaylis [27]

Answer:

H>D>G>J>A>E>I>B>F>C

H: DIAMOND

D: CORUNDUM

G: TOPAZ

J: QUARTZ

A: FELDSQUAR

E: APATITE

I: FLOURITE

B: CALCITE

F: GYPSUM

C: TALC

Explanation:

I found the full question on the test . Following is the complete answer

1. J>A>E and J>A>I

2. C is the softest. C is Talc

3. E>I ⇔ J>A>E>I

4. F>C

5. On the full question, B can scratch mineral F but it can be scratched by all the other minerals except C. B>F>C

6. H is the hardest. H is Diamond

7. D is Corundum

8. H>D>G>J

Combine all the information, we have the following:

H>D>G>J>A>E>I>B>F>C

4 0
3 years ago
Other questions:
  • Do your cells use food to directly power their various functions? Explain your answer.
    14·1 answer
  • As a period of drought begins, how would infiltration and condensation change initially? What would happen to these two processe
    7·1 answer
  • What is a series of events that cells go through as they grow and divide?
    13·2 answers
  • The cis face of the golgi apparatus is also called what region
    12·1 answer
  • In the human body: Select one: A. the bacterial cells are larger than the eukaryotic cells. B. archaea can survive, but bacteria
    5·1 answer
  • A person with blood type B gets severely injured and needs a blood transfusion. What blood type would a person need to be in ord
    15·1 answer
  • Where does osmosis take place
    7·1 answer
  • Acetylcholine is found in the synapse between muscles cells and neurons. It can be broken down by the enzyme acetylcholinesteras
    13·1 answer
  • 4. Why<br> are stomata important to a plant?
    5·2 answers
  • What is the written description of Hydrolysis?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!