1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FinnZ [79.3K]
2 years ago
14

Pls help me!!

Biology
1 answer:
klio [65]2 years ago
4 0

Answer:

In explanation.

Explanation:

What is a punnett square used for?

It is a way to store data and keep track of things. It helps to predict the variations and probabilities that can come from cross breeding.

What do the probabilities of the possible offspring all add up to?

All can have 100%, 75%, 50%, or 25% depending on the specific trait.

You might be interested in
Why are cells small instead of large
Lunna [17]

"Cells are so little, so they can maximize their ratio of surface area to volume. Smaller cells have a higher ratio which allow more molecules and ions move across the cell membrane per unit of cytoplasmic volume. Cells are so small because they need to be able to get the nutrients in and the waste out quickly."


8 0
3 years ago
Read 2 more answers
If one plant is named Salvia greggii and another is named Salvia vanhouttei, what does this tell you about these plants?
Ronch [10]

Answer:

If one plant is named Salvia greggii and another is named Salvia vanhouttei, what this tells me about these plants is that they belong to the same genus and to different species. If you remember from your biology classes, genus always has the first capital letter, and species is all in lower case.

Explanation:

5 0
2 years ago
Read 2 more answers
Biogeochemical cycling ensures that
sammy [17]
A chemical substance that an organism requires to live. a nutrient that is scarce or cycles slowly through an ecosystem. ensures that nutrients will be circulated throughout the biosphere.
7 0
3 years ago
Which is an adaptation that helped plants survive on land?
ANEK [815]

Answer:

Formation of cuticles. (A P E X)

Explanation:

6 0
3 years ago
In the human body, sodium—a component of salt—balances fluids, such as water, in the body. Explain how the onion experiment show
Bogdan [553]

Answer:

The salt worked like sodium on the onion.

Explanation:

5 0
3 years ago
Other questions:
  • When a blacksmith is working with hot metal, what places does the thermal energy go?
    14·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is an El Nino-southern oscillation event
    14·1 answer
  • How do vaccines prevent disease?
    6·1 answer
  • Begin by considering a relaxed muscle. In this state, the myosin molecules of the thick filaments are not in contact with the ac
    7·1 answer
  • Which of the following molecules do we typically analyze by SDS-PAGE?
    5·1 answer
  • What is responsible for changing the shape of the cell?
    13·1 answer
  • What is the importance of the organization of spindle fibers during cell division?
    10·2 answers
  • A high-fiber diet may improve blood cholesterol measurements because Multiple select question. increased insulin secretion resul
    12·1 answer
  • A cylinder has a radius of 3 and a height of 5 what is the volume of the cylinder
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!