1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
3 years ago
15

What is the resistance of a 20-cm-long column of blood in this artery? assume that resistivity of blood is equal to 1.6 ωm.

Biology
1 answer:
Alinara [238K]3 years ago
7 0
The way in which you need to solve this is by using the formula:
<span>R = ρL/A 
</span>That one is the formula that demonstrates <span>Resistance of a wire in Ω.
The formula can be explained like this: 
</span><span>ρ is resistivity of the material in Ω-m </span>
<span>L is length in meters </span>
<span>A is cross-sectional area in m² </span>
<span>A = πr², r is radius of wire in m 
As soon as you have your numbers, you can replace and proceed to get the asnwer</span>
You might be interested in
In what ways are plants involved in the carbon and oxygen cycles?
slega [8]

Answer:

Plants use carbon dioxide in a process known as photosynthesis. In this process Plans give off oxygen as a waste product carbon dioxide moves from the air into the leaves of plants through tiny openings in the plants leaves

Animals and plants are connected to each other by the oxygen Carbon dioxide cycle

7 0
2 years ago
Read 2 more answers
Virulent viruses multiply infected cells and eventually cause the cell release new viruses by a process called
Dahasolnce [82]
Hey there Strongl9485,

Answer:

Lysis of the host cell

Hope this helps :D

<em>~Top♥</em>
8 0
3 years ago
Why do multicellular organisms perform mitosis and meiosis ?
Aleks04 [339]

Answer:

Multicellular organisms depend on mitosis for growth and repair. When an animal, plant or other multicellular organism grows, it makes more cells through mitosis. Organisms can repair some of their tissues, using mitosis to regenerate new cells.

Explanation:

4 0
2 years ago
A Frog lays thousands of eggs because many eggs die. This behavior is an example of what
Snowcat [4.5K]
This would be an example of overproduction. The frog lays thousands of eggs, which is more than it needs, or would need in perfect conditions.
6 0
2 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • The diagram above shows the succession of communities from annual plants to hardwood trees in a specific area over a period of t
    6·1 answer
  • A gene cannot react chemically and form a trait without the proper what?
    5·2 answers
  • What is the difference between eukaryotic and prokaryotic cells?
    15·1 answer
  • Select all that apply
    7·2 answers
  • Why is feedback inhibition important to the human endocrine system??
    6·2 answers
  • What do aerobic respiration and anaerobic respiration have in common?
    15·2 answers
  • Describe the general trend of this graph
    6·1 answer
  • Discuss what conditions are necessary for thunderstorms to form, and what conditions are necessary for
    13·1 answer
  • Stars with greater overall mass are ___ and ___, and they consume their nuclear fuel
    9·1 answer
  • Gas exchange between the air in the lungs and the blood takes place in the Select one: a. alveoli. b. primary bronchi. c. termin
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!