1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
padilas [110]
2 years ago
8

What way does ribosomes mobe.

Biology
1 answer:
anyanavicka [17]2 years ago
5 0
Forward
The ribosome moves forward on the mRNA, codon by codon, as it is read and translated into a polypeptide (protein chain). Then, once translation is finished, the two pieces come apart again and can be reused.
You might be interested in
Need help with Bio criss cross puzzle "Monerans"
vredina [299]
14. Staphylococcus 19. Enteric 21. Bacteria 23. Facultative 25. Yogurt 27. Glycocalyx 28. Antibiotic
6 0
4 years ago
Which of the following is the least likely to increase the rate of diffusion? A. Small concentration gradient. B. Higher tempera
Pavlova-9 [17]
<span>The rate of diffusion of a substance depends on four factors which are: temperature, concentration gradients, diffusion distance and the diffusion and host material. The rate of diffusion is affected by differences in concentration gradient; the higher the difference in concentration gradient, the higher the diffusion rate. Thus, small concentration gradient will not increase the rate of diffusion. The correct option is A.</span><span />
8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The frequency of alleles in a population that is in hardy Weinberg equilibrium
Olenka [21]
I don't get your question, this can be helpful though To explore the Hardy-Weinberg equation, we can examine a simple genetic locus at which there are two alleles, A and a. The Hardy-Weinberg equation is expressed as: p² + 2pq + q² = 1. where p is the frequency of the "A" allele and q is the frequency of the "a" allele in the population. Goodluck
8 0
3 years ago
Read 2 more answers
Organic material provides nitrogen for plants. Which soil component contributes the most nitrogen to plants? Clay. Hummus. Sand.
klasskru [66]
Don’t click the link it’s a scam
8 0
3 years ago
Other questions:
  • What is MKS system?​
    7·1 answer
  • Hungaaroons can have straight hair, wavy hair, or curly hair. Straight hair is caused by having two of the same allele (SS). Cur
    5·1 answer
  • Which is a reliable source of scientific information
    14·1 answer
  • 17. How do the cells in meiosis differ from the cells in mitosis?
    8·2 answers
  • Which of the following best describes a population?
    7·2 answers
  • What's the meaning of DNA​
    5·1 answer
  • I am a real "powerhouse" 
    5·1 answer
  • The apparent position of the fish is different from the actual position of the fish. What has happened to the light passing thro
    8·1 answer
  • Our biggest loser went from 403lbs to 288lbs. He lost a total of 215lbs. Explain what happened to the 215lbs. Be sure to discuss
    9·1 answer
  • What are the three main differences between active transport and passive transport?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!