Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
They are part of the stomatal can be found in the skin of the leaf and stem. Guard cells have characteristic shapes can be bean-shaped or like sponge cake. They have thickened cell walls contain living protoplasm of chloroplasts (as opposed to skin cells)
Answer:
The correct answer is - option a.
Explanation:
Pubis or the pubic bone is one component bone of the right and left coxal bone articulate together. This bone makes the pelvis, in the female uretheral sponge covers the pubic bone from front.
The pubic bone is also makes the inferior and anterior obturator foramen. The pelvic bones are joint together to pubic symphyasis.
Thus, the correct answer is - option a.
Answer:
prophase would be the stage when the nucleus membrane break to allow the chromosomes to get ready for metaphase.
