Answer:
A Cricket Flour is a Complete Protein
Amino acids are the building blocks of protein. They form nearly every tissue in your body. Cricket protein is considered a “complete protein” because it contains all nine essential amino acids.
Explanation:
The difference between a tornado watch and a tornado warning is a tornado watch means that there was a tornado spotted in an area/town nearby. And a tornado warning means that there is a tornado heading towards your town/area or that there already is a tornado in your town/area. Hope this helped!
Answer:
The carbon cycle with 4 boxes connected by arrows. Box 1: carbon dioxide in the atmo… ... 4 boxes connected by arrows. Box 1: carbon dioxide in the atmosphere. Box 2: X. Box 3: consumers eat producers. Box 4: Y. The arrow that follows box 4 connects to box 1. Which labels best complete the flow chart?Explanation:
Answer:
DNA: ATGGGGGCGATATTTTATCCGACG
RNA: AUGGGGGCGAUAUUUUAUCCGACG
Protein: MGAIFYPT
Explanation:
Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.
