1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MissTica
3 years ago
6

Can someone rephrase this "The climate in the boreal forest is characterized by long, very cold, dry winters and short, cool, mo

ist summers. The boreal forest is teeming with life. ... Their conical shapes reduce snow buildup on branches in winter, so that they do not break under the snow load." Thank you!​
Biology
1 answer:
Arte-miy333 [17]3 years ago
6 0

Answer:

"Long, bitterly cold, dry winters and short, cool, damp summers define the boreal forest climate. The boreal forest is alive with activity. In the winter, their conical forms decrease snow buildup on branches, preventing them from breaking under the weight of the snow."

Explanation:

Hope this helps! :)

You might be interested in
The heat you feel when you put your hands above fire?
Alexandra [31]

Convection, you are heating the air around your hands.

7 0
3 years ago
Help me please<br> If you help me you get brainliest answer and 20 points!!!!!!
seropon [69]

Answer:

I belive the answer would be D.

Give Brainliest plz

3 0
3 years ago
Read 2 more answers
Explain how the development and improvement of microscopes changed the study of living organisms.
nlexa [21]

Answer: As scientists started improving on the microscopes, the more they got to observe the cells in depth. Compound light microscope uses visible light to produce a magnified image and doesn't allow it to scatter.

3 0
3 years ago
Use the picture to summarize the difference between the daughter cells that result from mitosis and meiosis.
Ugo [173]

Answer: Mitosis results in two diploid cells that have the same genetic makeup. Meiosis results in four haploid cells that are all genetically different from each other.

3 0
3 years ago
Which of the following is/are true?
Softa [21]

Answer: Only Options A, C and E are correct

A) Sympatric speciation is best described as a random event that disrupts the allele frequencies in a population

C) Sympatric speciation does not require geographic isolation.

E) Sympatric speciation can be due to sexual(mate) selection

Explanation:

Sympatric speciation is a random or naturally occurring event whereby organisms of the same species:

> live in the same territory or nearby territories ( i.e not living in isolation)

> DO NOT interbreed, but select a sexual mate from a much diverse territory which results in an uneven gene flow or disruption of alleles among the population of same species of the parents organisms.

3 0
3 years ago
Other questions:
  • A red blood cell placed in a hypertonic solution will shrink in a process called crenation. A red blood cell placed in a hypoton
    9·2 answers
  • One specific _____ is RNA.
    9·1 answer
  • Intense competition would most likely occur between?
    9·2 answers
  • Which two structures would provide a positive identification of an animal cell under a microscope?
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A star with a surface temperature between 5,000 K and 6,000 K appears _____. blue yellow red white
    13·1 answer
  • Which series shows a correct path of energy flow in a marine food chain?
    11·1 answer
  • A.5<br><br> B.6<br><br> C.10<br><br> D.12<br><br> Help plz question is 30 points!
    9·2 answers
  • What are non-examples of climate
    9·1 answer
  • What appears to happen to the moon as it goes through its cycle?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!