1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kazeer [188]
3 years ago
14

Which part of the plant releases energy from food

Biology
2 answers:
sp2606 [1]3 years ago
6 0

Answer:

Chloroplast

Explanation:

Grace [21]3 years ago
5 0

The Mitochondria of a plant cell releases energy from the food. It is a cell organelle and is present in the cytoplasm. They make most of the essential ATPs (Adenosine Tri Phosphate).

You might be interested in
What might happen if taxi and police radios used the same frequency band?
artcher [175]

Answer:Taxi's might get private police channels , and police radios would pick up unnecessary channels

Explanation: not sure if that's what you mean

4 0
3 years ago
Which experiment is more likely to be reliable, and why ?
tigry1 [53]
Since there’s nothing here other than what you’ve asked i’ll guess, an experiment that is more likely to be reliable will not use the first values it gets, will be done multiple times and the values will be close in number
3 0
4 years ago
1. Which type of reaction has water in its products?
Sonja [21]

Answer:

1. b. Dehydration synthesis

2. a. Hydrolysis

Explanation:

Hydrolysis is the process where water is used to break chemical bonds. Dehydration synthesis is the reverse reaction, where a bond is formed resulting in the loss of water from the molecule, so a water molecule is generated as a product.

That means that dehydration synthesis produces water, and hydrolysis uses water.

7 0
3 years ago
Read 2 more answers
WILL MARK BRAINLIEST!! HELP ME PLS I DON'T GET THIS
padilas [110]

Answer:

Genotype ratio Tt:tt=1:1

Phenotype ratio 1:1

Explanation:

the phenotype ratio should be 1:1 since there are 2 individuals with the dominant allele and 2 without it

The genotype ratio should be 1:1 for the same reason

6 0
3 years ago
At the end of DNA replication, each of the two new DNA molecules is composed of which of the following? *
dybincka [34]

Answer:

B

(The result of DNA replication is two DNA molecules consisting of one new and one old chain of nucleotides. This is why DNA replication is described as semi-conservative, half of the chain is part of the original DNA molecule, half is brand new.)

4 0
3 years ago
Other questions:
  • _ is a hormone which causes _to be broken down to form _.
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • PEASE HELP!!!!! the cells in your nose that detect smell are a type of? A. chemoreceptor B. propipceptor C. efferent receptor D.
    14·1 answer
  • In the beginning of of platelet plug formation, the chemical produced by endothelial cells at the site of injury is called _____
    10·1 answer
  • Active transport requires select one:
    7·1 answer
  • Genetic variation occurs when chromosomes are shuffled in fertilization and what other process?. mitosis mutation meiosis geneti
    14·2 answers
  • If you have car sickness, but only when you look at a book or screen while its moving, is there an exact terminology for it?
    7·2 answers
  • A male and female Oompah have the same genotypes: blue face (ff) and big feet (Ll). Determine what they’re offspring may look li
    7·1 answer
  • I will give brainlist
    9·1 answer
  • In an individual heterozygous for a single trait, the probability of the recessive allele being present in a gamete is ______. M
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!