1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aev [14]
2 years ago
8

I need this now,I'll give you 100 points for answer 10 questions.

Biology
1 answer:
Kipish [7]2 years ago
7 0

Answer:

1) B

2) C

3) C

4) C

5) C

6) A

7) A

8) A

9)  A

10) C

Explanation:

Hope this helps

You might be interested in
BEFORE equilibrium has been reached in this container: (Circle a letter for each) 1. Movement of glucose across the membrane in
qwelly [4]

Hello. You forgot to put the image so that this question can be answered, but I will describe what the image shows.

The image shows two types of "cups" that have a type of connection between the two. In cup A there is 1 mole of glucose and 1 mole of fructose. In cup B there is 0.1 mol of glucose and 1.5 mol of fructose.

Answer:

A. Solution A to Solution B

Explanation:

Balance is achieved when the "cup" with the lowest concentration of glucose receives glucose from the "cup" with the highest concentration, to the point that the two glasses establish equal concentrations of glucose between them.

We know that cup B has a lower concentration of glucose, which indicates that the movement of this solute was from cup A towards cup B. With this we can conclude that the letter A is the correct answer.

3 0
3 years ago
Wanda is in labor. Which hormone is causing her uterus to contract for childbirth?
lakkis [162]
Oxytocin. It apparently kick starts labour and causes contractions.
7 0
3 years ago
Read 2 more answers
Explain biodiversity in your own words ​
Drupady [299]

Answer:

this is a type habitat or ecosystem

Explanation:

3 0
3 years ago
Ribosomes are the site where
leva [86]

Answer:

Ribosomes are the site where proteins are produced

Amino acids are coded for by triplet bases in RNA called codons.

Explanation:

its me i get it right lol

4 0
3 years ago
Read 2 more answers
I NEED HELP ON A QUICK QUESTION!
umka2103 [35]
I would go with lipids:) hope it helps

7 0
3 years ago
Read 2 more answers
Other questions:
  • Panic grass (Dichanthelium lanuginosum) can live in geothermally heated soils only when the fungus Curvularia protuberata is pre
    15·1 answer
  • Help me answer this question please.
    10·1 answer
  • what happens to the thickness of the uterine lining when the level of the hormone progesterone reaches its highest levels
    5·1 answer
  • Arthropods like mites and ticks can transmit rickettsial diseases True or False?
    11·2 answers
  • What trend do you notice about proteins and fats in the graph?
    5·1 answer
  • Someone please thoroughly explain lac operon and trp operon<br> Thanks
    15·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Answerr these questions please!!! will mark brainliest. They are simple
    11·1 answer
  • If you’re good in biology/science, plzzz help!
    10·1 answer
  • Can someone help me with this question plss
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!