1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Xelga [282]
3 years ago
6

PLEASE HELP WITH THE FOLLOWING

Biology
1 answer:
makvit [3.9K]3 years ago
4 0
The answer is D both processes produce puruvate
You might be interested in
Acid rain occurs when sulfur dioxide is he atmosphere is oxidized in the presence of nitrogen dioxide. Acid rain is an example o
Ierofanga [76]

Answer:

A secondary pollutant

Explanation:

Pollutants can broadly be classified into two main categories based on their formation or synthesis. 1: Primary pollutants, 2: Secondary pollutants.

1: Primary pollutants

Primary pollutant can be considered as any environmental pollutant that is being directly emitted from a certain source like when we burn coal carbon di oxide is directly emitted into the atmosphere so CO2 is a primary pollutant.

Similarly sulfur di oxide or SO2 is also a primary pollutant that is emitted by the gas emissions of motor vehicles.

2: Secondary pollutants:

On the other hand, secondary pollutant is something that is not directly emitted on earth as an environmental pollutant but some how it is formed due to a reaction of primary pollutant.

Such as mentioned in the question that SO2 when oxidized in air in the presence of enzymes and water, it form H2SO4 or acid rain which directly falls on earth and incurs great amount of damage to not only living organisms but also non-living organisms such as marble buildings.

Therefore, acid rain is secondary pollutant. Please see picture for better understanding.

Hope it help!

3 0
3 years ago
Many protists can move. what are some structures mentioned that can help protists move.
Ksivusya [100]

Answer:

cilli and flagella

Explanation:

I think there is one more but not sure hope this helped

(also if spelling is weird sorry I tried)

6 0
3 years ago
Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainli
spin [16.1K]

Answer:

Bottom Right is the answer

Explanation:

There u go

5 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
How would a object blocking a bronchus affect this air flow
Blababa [14]

Because the lung has two bronchi, it can still function if one bronchus is blocked by a foreign object. No gas exchange will happen to the affected side, and the other lung will compensate for the loss of air. The blocked portion though can become inflamed and can lead to infection and damage.



3 0
3 years ago
Read 2 more answers
Other questions:
  • 16. Is a bear an ENDOTHERM or ECTOTHERM?
    10·1 answer
  • What provides the energy that drives the water cycle?
    5·1 answer
  • 1. How do plants on Earth affect the amount of carbon in Earth’s atmosphere?
    7·1 answer
  • Describe the relationship between science and technology, and give an example of how they are related? LET ME KNOW THE ANSWER PL
    9·1 answer
  • True / False: Taking a faster, deeper breath which allows you to move a greater volume of air into the lungs is due to a smaller
    11·1 answer
  • What is the most important difference between vertebrates and invertebrates
    15·1 answer
  • Farming is ___________ due to dense vegetation
    5·2 answers
  • _____ bond together to form molecules.a. protonsb. ionsc. atoms
    9·1 answer
  • Need help asap <br> question two<br> - 20 points
    9·2 answers
  • Enzyme complexes that break down protein are called _____. lipases ubiquitins amylase proteasomes nucleases
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!