1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhuklara [117]
2 years ago
9

How is a snake biotic

Biology
2 answers:
astraxan [27]2 years ago
6 0

Answer:

The term biotic factors refers to the way in which an organism -- such as a snake -- interacts with its environment or ecosystem. ... Biotic factors of snakes involve how they impact the necessary balances that make their ecosystem function, especially with regard to a snake's role as both predator and prey.

Alexeev081 [22]2 years ago
5 0
A snake is biotic because it is living biotic is living, abiotic is non-living.
You might be interested in
some fossils provide evidence to suggest that earths climate has changed over time ? check all that apply
irga5000 [103]
What are the options
6 0
3 years ago
Which statement is true?
melomori [17]
The answer would be B.

Oxygenated blood is pumped from the left ventricle into the aorta and supply cells of all organs with oxygen and nutrients.
4 0
3 years ago
Read 2 more answers
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Please help me!!! I dont know what it means!
user100 [1]
The correct answer is C.............

6 0
3 years ago
Astrology is the study of earth moon and stars in space yes or no
hoa [83]
No, astronomy is the study of space
3 0
3 years ago
Read 2 more answers
Other questions:
  • 6−3q≤1 solve the problem for 25+ points
    8·2 answers
  • A bend in a river shaped like a loop is called a(n) _____________
    14·2 answers
  • A geneticist discovers an obese mouse in his laboratory colony. He breeds this obese mouse with a normal mouse. All the F1 mice
    12·1 answer
  • my question to you guys is DO YOU WANT FREE RBX!? all you have to do is follow this username (xxxnickslayer101) for a chance to
    8·2 answers
  • How does the amount of a rocket's thrust affect its trajectory? What does it take for an orbiting spacecraft to escape its orbit
    5·1 answer
  • The appendix, an extension of the large intestine appears, although this is debated, to have little
    15·1 answer
  • How would a sudden disease among the essential primary producers In an
    13·1 answer
  • What is the independent and dependent variable? Two groups of students were tested to compare their speed working math problems.
    15·1 answer
  • Which of the following is a BEHAVIORAL adaptation?
    6·1 answer
  • What makes a judas goat stop being social?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!