1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
baherus [9]
2 years ago
6

Because land routes were dominated by the ottoman Empire, Europeans had to -

Geography
1 answer:
tresset_1 [31]2 years ago
4 0

With the Ottoman empire controlling overland trade routes, the Europeans began to <u>search for a </u><u>water route </u><u>to </u><u>Asia</u><u>. </u>

<h3>European marine trade with Asia</h3>
  • Started after the Portuguese successfully sailed around Africa to get to Asia.
  • Was as a result of the Ottomans controlling overland trade routes.

The Europeans were Christians and did not want to be held hostage by the Muslim Ottoman empire controlling their trade with Asia. They therefore sought another way to get to Asia and did so around Africa.

In conclusion, option B is correct.

Find out more about the P<u>ortuguese sailing around Africa</u> at brainly.com/question/262829.

You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
2 years ago
When Reading a textbook blank.
natali 33 [55]

Answer: b is the answer to this question

Please Mark me as brainiest

7 0
3 years ago
What is located at equal distance from the North Pole and south pole
Vlad [161]
The PERIMETER of the equator cycle is about 40,000Km. The Greenwich cycle is a bit shorter as the earth is a bit an ellipsoid. About 37,000Km by Google Maps. The distance on the envelope between ANY antipodes (=opposite points on the axis, I won't use "diameter" to avoid confusion) is HALF the perimeter (If you walk the whole perimeter long, you'd get to the same point, of course). The distance through Earth is

D=P/Pi=37,000Km/Pi=about11777Km
7 0
3 years ago
Read 2 more answers
QUESTION 4
alina1380 [7]
Miscegenation. Hope this helps:)
6 0
2 years ago
Dudcjujiudhcurehveru9hvf8uhvuf8evhfu8vhy8vh fuvhf7uvhu
Kruka [31]

Answer:

beep boop beeep

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • It is the early 1900s. A vast empire has recently collapsed. Now the empire’s subjects control their own future. What of the fol
    10·2 answers
  • The gas and debris that surrounds the surface of the nucleus of a comet is called the
    6·1 answer
  • 5. Which area of the world has experienced the greatest population growth over the past 10
    5·1 answer
  • Feel free to use your notes and the textbook to help you answert the questions!
    8·1 answer
  • Was Robespierre to blame the terror answer in short paragraph
    11·1 answer
  • Phatik's uncle lived in​
    12·1 answer
  • Question 20 of 20
    8·1 answer
  • Imagine the Earth’s orbit were changed to be a perfect circle around the Sun so that the distance between the Earth and Sun neve
    15·1 answer
  • An area marked by abundant magmatic activity = __________________
    7·1 answer
  • What is a skew and parallel
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!