1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ruslelena [56]
3 years ago
5

How are neurotransmitters and hormones similar and how are they different?

Biology
1 answer:
ratelena [41]3 years ago
5 0

Answer:

Both neurotransmitters and hormones influence our thoughts and motivations, as well as our ability to learn and concentrate. However, neurotransmitters are short-lived while hormones act for longer periods of time.

You might be interested in
I) predict which of the liquids would cause the largest decrease in mass of potato stick
oksian1 [2.3K]

Answer:

1 mol per dm3 sodium chloride solution

Explanation:

The liquid that would cause the largest decrease in the mass of the potato stick would be the one with  <u>1 mole per dm3 sodium chloride solution.</u>

<em>The water potential of a solution depends on the molarity of the solution, the higher the molarity, the lower the water potential and vice versa. Hence, a solution with higher molarity has the tendency to osmotically draw more water from the potato stick than a solution with lower molarity.</em>

Therefore, the potato stick will have the largest decrease in mass in 1 mol per dm3 sodium chloride when compared to the 0.5 and 0.1 mole per dm3 solutions.

5 0
3 years ago
Eukaryotes have their DNA arranged in numerous double-stranded, linear DNA molecules bound with proteins; these structures are c
Elden [556K]

Answer:

In eukaryotes, the genome comprises several double-stranded, linear DNA molecules bound with proteins to form complexes called chromosomes

3 0
4 years ago
A generator consists of a rotating wire coil placed in a magnetic field. This process transforms mechanical energy into ________
Yakvenalex [24]

It would be electrical

6 0
3 years ago
Read 2 more answers
The two main types of fermentation are called
jok3333 [9.3K]
The two main types of fermentation are alcoholic fermentation and lactic acid fermentation. In an alcoholic fermentation, the main product of this process is ethyl alcohol. Lactic acid on the other hand has lactic acid as its main product. When muscle cells run out of oxygen, lactic acid fermentation would commonly take place.<span> </span>
7 0
3 years ago
Choose 6 liquids to layer. Hypothesize what you expect their densities to be. What liquids did you use, and rank their density w
Lemur [1.5K]

Answer:

Let's pick six liquids randomly, i.e. honey, corn syrup, whole milk, water, vegetable oil, rubbing alcohol, and put them in a beaker. The higher density liquid will take the bottom position whereas lower density liquids will be on above of high density liquids.

We know that honey has density (g/cm3) of 1.42, dish soap has 1.06, corn syrup has 1.33, milk has 1.03, water has 1.00 (standard), and vegetable oil and 0.92. Therefore, honey will be at the bottom most position (rank #1). Above which would be corn syrup (rank #2), dish soap (rank #3), milk (rank #4), water  (rank #5) and vegetable oil (rank #6).

The results might be surprising for some students who think that water has highest density.

7 0
3 years ago
Other questions:
  • How will other organisms be<br>affected by the buffalo's return to<br>the ecosystem?​
    9·1 answer
  • _________ are not open to viewers and are for alcoholics having a serious desire to completely stop drinking. question 11 option
    9·1 answer
  • Which of the following groups is present in amine compounds?
    10·1 answer
  • Which observation tool is the most advanced?
    14·2 answers
  • Will mark brainliest
    13·2 answers
  • Chemical reactions occur when molecules or atoms collide so that the bonds between atoms break and new bonds form. Breaking the
    11·1 answer
  • The development of specific plant structures in particular locations is called pattern formation. Events in a plant's early deve
    6·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • The roots of the plant in the diagram above are exhibiting which behavior?
    15·2 answers
  • Chlorophyll appears green because it…?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!