1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tatiana [17]
2 years ago
13

What is a population?

Biology
1 answer:
Fofino [41]2 years ago
6 0
B. Populations are a group of the same species in a place at the same time.
You might be interested in
Explain what trees are made of, using the evidence van Helmont, Woodward, Malpighi, and Hales collected.
olya-2409 [2.1K]

The answer to this question would be: The soil

8 0
2 years ago
Describe how ATP is produced in the light reactions.
Lynna [10]

Answer:

Explanation:

Two reactions take place that produce raw materials for the dark stage:  

  1. Light energy splits the water molecules into <em>hydrogen</em> and <em>oxygen</em>
  2. This process is called <u>photolysis  </u>

The hydrogen is taken up by a hydrogen acceptor called Nicotinamide adenine dinucleotide phosphate (NADP) while oxygen is released as a by-product  .

2 H₂O(l) --------->light energy -------> 4 H + O₂ (photolysis

)

Light energy strikes the chlorophyll molecules and sets in motion a series of reactions resulting in the production of a high energy molecule called <em>Adenosine Triphosphate</em> (ATP)

Hope this helps.

5 0
3 years ago
Glycolysis is a part of cellular respiration that takes place in the absence of oxygen.
Marta_Voda [28]

Answer:

Explanation:

Glycolysis is an anaerobic process - it does not need oxygen to proceed. ... They follow glycolysis with the Krebs cycle and electron transport to make more ATP than by glycolysis alone. Cellular respiration that proceeds in the presence of oxygen is called aerobic respiration.

5 0
3 years ago
Cell a has no membrane proteins at all. cell b has aquaporin membrane proteins. both cells are placed in a hypertonic solution.
Viktor [21]

b is correct answer for question

5 0
3 years ago
He photosynthetic cells in the interior of a leaf are what kind of cells?
siniylev [52]
Cell wall or membrane
6 0
3 years ago
Other questions:
  • Describe the process of generating geothermal electricity by outlining the steps involved. Take your description from the drilli
    5·1 answer
  • What is oil of vitriol called
    5·2 answers
  • The atomic number of a element is determined by the number of
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Help me out fast please hurry​
    13·1 answer
  • Please help!!<br> How do living organisms maintain homeostasis on a cellular level?
    14·2 answers
  • Genes D, E, F, and G are located on the same chromosome. The distances between the genes are below:
    12·1 answer
  • Write a sentence with the word Fetal period<br><br> Please help !!
    8·1 answer
  • Granite forms when liquid magma slowly cools within the Earth's crust. Basalt can form when lava cools on Earth's surface. What
    13·2 answers
  • I’ll mark u as brainliest!
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!