Hyaline cartilage makes up the costal cartilage that holds the ribs to the sternum. The most prevalent form of cartilage in the body is hyaline cartilage.
<h3>What is hyaline cartilage?</h3>
On the articulating surfaces of bones, in the larynx, trachea, and bronchi, as well as on the sternal ends of the ribs, hyaline cartilage is present. It imparts a rigid yet malleable form to the constructions.
Hyaline structures are connective tissues that anchor the ribs onto the sternum. Such structures and joints are robust because collagen fibers are present, but their mobility and flexibility are constrained. To reduce friction and provide cushioning at the joint surface, articular cartilage, also known as hyaline cartilage, covers the ends of bones.
Learn more about hyaline cartilage here:
brainly.com/question/7283023
#SPJ1
I believe the correct answer is DDT.
It kills mosquitoes but thins the eggs of birds.
Hope this helps.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
We should not touch electrical appliances with wet hands because our body is a good conductor of electricity and since we may get electric shocks. ... Also one should avoid getting wet while touching electrical appliances because water is also a conductor not pure one though
Explanation:
Answer: The Dust Bowl was caused by several economic and agricultural factors, including federal land policies, changes in regional weather, farm economics and other cultural factors. After the Civil War, a series of federal land acts coaxed pioneers westward by incentivizing farming in the Great Plains.
Explanation:
1) Manifest Destiny: The US Government wanted settlers to move onto the Plains as they needed the land to be settled and farmed and for communities and towns to grow up and expand. This was needed if the USA was to be a rich and successful country. The government therefore promoted the idea of Manifest Destiny.
