1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luba_88 [7]
3 years ago
11

I’ll give BRAINLIST??What organs/organs systems does schizophrenia affect and how does it affect it?

Biology
2 answers:
Ierofanga [76]3 years ago
8 0

Answer:

Schizophrenia is associated with changes in the structure and functioning of a number of key brain systems, including prefrontal and medial temporal lobe regions involved in working memory and declarative memory, respectively.

Explanation:

Have a great day!

trasher [3.6K]3 years ago
3 0

Answer:

centeral nearvous system

Explanation:

You might be interested in
What do we call a specific variant of a character?<br> A.gene<br> B.trait<br> C.locus
Aneli [31]

Answer:

Trait

Explanation:

We call a specific variant of a character a phenotypic trait.

5 0
3 years ago
Which organs shown in the transparency are part of the frog's nervous system?
In-s [12.5K]
The nervous system in a frog controls the activities of the organs of the body. It also would regulate the internal environment in one's body. All the organs which are also the same parts of nervous system of a vertebrate are present in a frog. The brain,spinal chord,the sympathetic and para sympathetic nerves,cranial nerves,spinal nerves,cranial nuclei and ganglia.
7 0
4 years ago
Use the words air and mass to describe cold and warm fronts
SVETLANKA909090 [29]
<span>A warm front is the boundary between a warm air mass and a cold air mass it is overtaking. So a cold front would be the opposite. 

</span>
7 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
WILL GIVE BRAINLEST, LOTS OF POINTS
Tema [17]

Answer:

1st, 3rd, 5th

Um the brainliest answer would be appreciated greatly :)

8 0
3 years ago
Other questions:
  • Within the global water cycle, water is stored for the shortest amount of time in…
    6·1 answer
  • Science rejects any hypothesis not supported by __________________________ and the results of ___________________________ experi
    15·1 answer
  • A population’s size in unaffected by the available resource supply. True or false
    8·2 answers
  • Why is the nucleus so important to a living cell?
    15·1 answer
  • It is important to maintain septic systems in order to _______.
    5·1 answer
  • Methanol poisoning occurs when the body converts a large amount of methanol to harmful chemicals that attack the optic nerves, l
    8·1 answer
  • During protein synthesis, an RNA strand is transcribed from one strand of DNA (GCG
    15·1 answer
  • What is the external stimulus in thigmotropism?
    10·1 answer
  • 1. What is another name for artificial selection?
    6·2 answers
  • Describe why sexual reproduction allows for more variations in a population when compared to asexual reproduction.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!