That should be your answer
Explanation:
The form y = mx + b gives the equation of a straight line where m is the slope of the line(the gradient) and b is the intercept of the line and the y axis.
All lines with the same gradient (i.e. the same number in front of the x) are parallel.
First, let's rearrange your line equation into the correct form of y = mx + b
2y-8x=-10 Move the x term across the equals sign, changing its sign as we do so 2y = 8x - 10 Now divide by 2 (through the whole equation) to get rid of the 2y and just leave y. y = 4x - 5 Now we can see that the line we want has a gradient of 4. it also intercepts the y axis when y = -5 The line we want is therefore y = 4x - 5 It is the same line as the one given!
Wildfires can occur anywhere but are common in the forested areas of the United States and Canada. They are also susceptible in many places around the world, including much of the vegetated areas of Australia as well as in the Western Cape of South Africa. The climates are sufficiently moist to allow the growth of trees, but feature extended dry, hot periods. Fires are particularly prevalent in the summer and fall, and during droughts when fallen branches, leaves, and other material can dry out and become highly flammable. Wildfires are also common in grasslands and scrublands.
I type fast so don't judge my quick answer
<span>two ways Western Europe's proximity to water affects its economy </span>
<span>Climate
</span>Economy
<span>.
politics.</span>
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
