1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WITCHER [35]
2 years ago
8

What is an important function of the urinary system?

Biology
1 answer:
77julia77 [94]2 years ago
3 0

Answer:

the kidneys are the most important function of the urinary system

Explanation:

mark me brainliest

pls and ty

<3 anmol

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
We need to recycle our waste because Earth is a closed system with respect to
Monica [59]

I disagree because although recycling is good, Earth firstly is not a closed system and new matter enters the environment all the time, such as comets.

5 0
3 years ago
What element is most commonly compared in science fiction stories?
STatiana [176]

Answer:

the answer is setting or "worlds"

7 0
3 years ago
Which group consists only of renewable resources? Question options: carbon, sunlight, water, aluminum coal, trees, water, carbon
iragen [17]

phosphorus, soil, water, oxygen

Explanation:

Phosphorus, soil, water and oxygen are renewable resources that can be found freely on earth.

Renewable resources are natural resources that can easily be replenished as they are used either by natural means or through cyclic processes in our human life time.

  • Phosphorus, soil, water and oxygen are easily replenished by natural processes and through the biogeochemical cycle of materials.
  • Fossil fuels, trees are not renewable as they can easily be depleted.
  • Non-renewable resources must be used sustainably to ensure their all round availability.

Learn more:

Renewable resources brainly.com/question/6944540

#learnwithBrainly

7 0
4 years ago
Read 2 more answers
What are barrier islands? What protects the barrier islands?
dem82 [27]

Answer:

Barrier islands form in three ways. They can form from spits, from drowned dune ridges or from sand bars. Longshore drift is the movement of sand parallel to the shore caused by the angle of the waves breaking on the beach. When a storm such as a hurricane digs an inlet through the spit a barrier island is formed. Barrier islands are a specific type of island that lie parallel to the coastline of a larger mainland. They are separated from shore by a bay, lagoon or sound and because of where they are situated, they protect the coast from being directly impacted by storm waves or winds.

Explanation:

3 0
3 years ago
Other questions:
  • What can you infer about the responsiveness of two neurons in the visual cortex that lie next to each other in v1?
    9·1 answer
  • Which of the following represents an ion? (1 point)
    9·1 answer
  • Plants have specialized structures that perform their necessary life functions. The gases that are crucial to proper
    5·2 answers
  • The isolation of cell-cycle mutations in yeast was greatly facilitated by the use of _______________ mutations, which allow inve
    15·1 answer
  • Which of the following would happen to a cell if cellular respiration suddenly ceased?
    6·2 answers
  • Which best describes the role of communication in scientific investigations?
    15·1 answer
  • What happened to the sun as the solar system was forming?
    10·1 answer
  • Science Can some one check my answers please Question 1
    15·1 answer
  • Which structure is unique to eukaryotic cells
    5·1 answer
  • Transmission through air borne droplets can be reduced by..
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!