1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dsp73
2 years ago
12

1. Which level of organization includes the most interactions?

Biology
1 answer:
nikklg [1K]2 years ago
7 0

Answer:

Biosphere

Explanation:

The biosphere contributes to life. The biosphere is important for the survival of our own lives, and it also it is the zone of the earth where the air, land, water, and other abiotic elements interact together to support our whole lives.

You might be interested in
What is one of the biological uses of Nitrogen? PLZ HELP
Lisa [10]

Nitrogen is a fundamental element required during the growth and development of any organism.

  • Nitrogen is a fundamental chemical element required to synthesize different biomolecules such as nucleic acids (either DNA or RNA) and proteins.

  • Amino acids are the bounding blocks of proteins, whereas nucleotides are the building blocks of nucleic acids, and both contain nitrogen.

  • All organisms in their growth phase requires nitrogen in order to synthesize these biomolecules (i.e., nucleic acids and proteins).

In conclusion, Nitrogen is a fundamental element required during the growth and development of any organism.

Learn more about nitrogen here:

brainly.com/question/15857199

5 0
2 years ago
Read 2 more answers
Power is the blank at which work is done?<br> Someone help fill in the answer plz
Elodia [21]
Power is the rate at which work is done.

Hope this helps!
6 0
3 years ago
Read 2 more answers
In interphase the dna is in the form of loose threads called
Eduardwww [97]
In interphase the dna is the form of loose threads called chromatin
3 0
3 years ago
How many years does it take to make 2.5cm of soil
kvv77 [185]
I Found 500 Years :D
6 0
3 years ago
Read 2 more answers
These photosynthetic protists produce one third of the Earth’s oxygen that is generated through photosynthesis.
Art [367]

Answer:

A

Explanation:

this is because these photosynthetic protists have chlororphyll which is capable to make their own food materials through photosynthesis

6 0
3 years ago
Read 2 more answers
Other questions:
  • 3. Which type of neuron carries messages within the central nervous system?
    5·1 answer
  • Structures as different as human arms, bat wings, and dolphin flippers contain many of the same bones, these bones having develo
    11·1 answer
  • What are Earth's ten biomes? A) tundra, taiga, grasslands, deciduous forest, chaparral, desert, desert-scrub, savanna, rainfores
    9·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • In your own words summarizing the reasons people left their home countries to start new lives in the United States
    14·1 answer
  • Type of potential energy stored in bonds between atoms
    6·2 answers
  • A conditional mutation expresses its mutant phenotype only under certain conditions (the restrictive conditions) and expresses t
    5·1 answer
  • Which of the following has the longest wave length
    6·2 answers
  • Minerals maintain their chemical structure and are not broken down during digestion.
    6·1 answer
  • in experiments by greene and colleagues (1987) with the tephritid fly zonosemata vittigera and the jumping spider phidippus apac
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!