1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dsp73
2 years ago
12

1. Which level of organization includes the most interactions?

Biology
1 answer:
nikklg [1K]2 years ago
7 0

Answer:

Biosphere

Explanation:

The biosphere contributes to life. The biosphere is important for the survival of our own lives, and it also it is the zone of the earth where the air, land, water, and other abiotic elements interact together to support our whole lives.

You might be interested in
If cells are constantly splitting, why aren't they getting smaller too? Half of a muffin is not as big as a whole muffin. When y
aalyn [17]
There Is a phase in mitosis called G0, which occurs before the other stages. jn this stage, cells grow in order to become big enough go divide, meaning cells take the time to grow in order to divide at the same sizs.
6 0
2 years ago
Read 2 more answers
Describe the typical principles used to identify topogenic sequences within proteins and how these can be used to develop comput
Rufina [12.5K]

Answer: The peptide sequence that is essential for protein insertion, orientation in membrane and for travelling into particular organelle is called a topogenics.

Explanation: Integral membrane proteins are found in all cellular membranes and carry out many of the functions that are essential to life. The membrane-embedded domains of integral membrane proteins are structurally quite simple, allowing the use of various prediction methods and biochemical methods to obtain structural information about membrane proteins.

5 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Hey can someone please help will mark brainliest
ankoles [38]

Answer:

C

Explanation:

Because pure oxygen cannot be absorbed by the lungs unless diluted or adding extra oxygen to it .

3 0
2 years ago
The figure below shows an organelle typically found in eukaryotic cells. Which of the following best describes the function of t
skad [1K]

<h3>But Were is a figure .....</h3>
3 0
2 years ago
Other questions:
  • How does the control group setup in an experimental differ from the other setups in the same experiment?
    9·2 answers
  • What is anabolism? Give an example. What is catabolism also give an example
    10·1 answer
  • The theory of ________ states that organisms that are better suited for their environment will survive and reproduce, while thos
    11·2 answers
  • The nonmetal family of the periodic table that wants to gain, lose, or share four electrons is the __________ family.
    10·2 answers
  • Please help me!!!!!!​
    11·1 answer
  • 3. Which of the following would represent a heterozygous pair of genes?
    12·1 answer
  • HELP!! <br><br> Stuck on this problem:
    15·2 answers
  • What is the structure of the forebrain that connects the two hemispheres of cerebrum?
    14·2 answers
  • Which organism has lungs?<br> frog<br> insect<br> fish<br> jellyfish
    9·1 answer
  • Which component of blood contains no nucleus or organelles and carries oxygen to body tissues?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!