The best answer among the choices given is option D. Both growth and reproduction is the <span>characteristic of living things that is important to the survival of a group of animals rather than an individual member of this group. These two are very important in order for the survival of all the living things on Earth. Without these things, life here on Earth will end.</span>
C. <span>eukaryotic cells contain organelles that are enclosed in membranes.</span>
There are various diseases and disorders that could arise from high levels of saturated fat and specfically bad cholesterol. From the renowned, cardiac arrest, atherosclerosis, hepatic steatosis, neurological diseases like cerebrovascular diseases; ischemia and hemorrhagic stroke, disoriented weight size and gain -obesity is also caused by the high concentrations of fat and bad cholesterol.
These disorders and complications are just the few of the many possible outcomes of the mentioned imbalance of fat. How? because there is too much lipid for the body to process and metabolize thus, breach of homeostasis.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
