1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
3 years ago
6

During an investigation, Steven filled two cups with the same amount of water and placed them in a 20 degrees Celsius room for 3

0 minutes. Cup 1 was filled with 5 degrees Celsius water. Cup 2 was filled with 35 degrees Celsius water. The diagram below shows the temperature of the cups at the beginning of the investigation.
Biology
1 answer:
lisov135 [29]3 years ago
6 0

Answer:

the question is not complete

You might be interested in
Who is a physician who specializes in diagnosing and treating diseases and injuries of the eye?
Keith_Richards [23]
Ophthalmology is the specialty dealing with disorders and injuries of the eye... And ophthalmologist is the specialist responsible. Do not confuse with a optometrist. An optometrist only does basic diagnosis and fitting for eye ware.
5 0
4 years ago
A_ chain is a model of how natter and energy pass through organism. each organism is at a different _ level
Elis [28]
Food for the first blank and trophic for the second blank
5 0
3 years ago
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
4 years ago
Communities of microorganisms reside naturally on your skin, in your mouth and nasal passages, and in your digestive and urogeni
aliya0001 [1]
<span>It is widely accepted that the microbiome has implications on health and disease. We rely on some of these organisms for health, while others can impact everything from disease to cognition in detrimental ways. The "human microbiome project" actually asserts that the microbiome is so important to us as a species, that we're better seen as a "human supraorganism", and understanding the microbiome is actually essential to understanding our own evolution.</span>
6 0
4 years ago
Do environmental or genetic factors affect growth of organisms most?
pav-90 [236]

Answer:

Examples of local environmental conditions could include availability of food, light, space, and water. Examples of genetic factors could include large breed cattle and species of grass affecting growth of organisms. The environment in which an organism lives plays an important role in modifying the rate and extent of growth. Environmental factors may be either physical (e.g., temperature, radiant energy, and atmospheric pressure) or chemical. Organisms and the cells of which they are composed are extremely sensitive to temperature changes; as the temperature decreases, the biochemical reactions necessary for life occur more slowly. A lowering of the temperature by 10° C (18° F) slows metabolism at least twofold and often more.

I copied this stuff from a bunch of different biology websites. It doesn't answer your exact question but I would have to say based on what I typed here it would be the environment that affects the growth of an organism more.

7 0
3 years ago
Other questions:
  • 7th grade question (easy)
    6·2 answers
  • If the water concentration inside a cell is higher than the water concentration outside the cell, water flows out of the cell. t
    8·1 answer
  • In the lungs, surfactant is secreted by ____ cells.​
    10·1 answer
  • Question:
    10·2 answers
  • 4. Why did Mendel remove the male organs from the flowers of<br> yellow plants?
    11·2 answers
  • Using the Letter and Numbers on this diagram, match the appropriate names for the structures or processes
    6·1 answer
  • Under normal conditions, glomerular filtration depends on three main pressures. From the list below, what are these three main p
    6·1 answer
  • Respiratory pigment​
    9·1 answer
  • During the winter months, mountains are often covered with snow. In the spring, the snow starts to melt, and it runs off the mou
    13·1 answer
  • Lederberg and Tatum demonstrated that genes from one bacterium can be transferred to and recombined with genes from a second bac
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!