1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DerKrebs [107]
2 years ago
10

What causes large amounts of air to move?

Biology
1 answer:
timofeeve [1]2 years ago
3 0

Answer:

There is a term "atmospheric circulation". It is when the air throughout the globe moves around. When the sun heats air near the equator more, and less at the poles. So the equator is warmer. The warm air near the equator moves either towards the south or the north, toward the poles. The warm air also rises up, and the cold air sinks. This is convection, but at a global scale. THis is also the cause of wind.

You might be interested in
A geologist discovers a sample of fine-grained rock made up of very small crystals. Based on its physical appearance, what can t
tensa zangetsu [6.8K]

Answer:

D. It formed from magma that cooled quickly

Explanation:

From several experiments, geologists have come to terms with the fact that when magma cools rapidly, it does not give room for large and big sized crystals to form. Instead, tiny, little crystals would be formed.

For example, obsidian and most volcanic rocks.

When a magma has enough time to cool and solidify, we see very big crystals of minerals in them.

3 0
3 years ago
The mass number of an atom is the same as?
Darina [25.2K]

Answer: Option C.

The number of protons and neurons it's contain.

Explanation:

Mass number of an atom is also called atomic mass of an atom which is some what expressed in Dalton i.e 1/2. The mass number is the total number of protons and neutrons altogether called nucleons in an atomic nucleus.

8 0
3 years ago
List 3 cellular components involved in metabolism that are influenced by temperature
stiv31 [10]

The three cellular components, which takes part in the process of metabolism and are affected by the modifications in temperature are ribosomes, cell membrane, and enzymes.

All these are formed of a certain type of protein, which can become denatured when exposed to high enough heat or stop gets functioning at too low temperature. The high temperature can disrupt the non-polar hydrophobic interactions and hydrogen bonds. This takes place as heat enhances the kinetic energy and makes the molecules to throb so briskly and viciously that the bonds get disordered.

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
How does diploidy help to preserve genetic variation? see concept 23.4 (page 498)?
mario62 [17]
Monoploid organisms reproduce asexually since they need to transmit all of their genetic material to their offspring. Diploid organisms, have 2 copies of their genetic material that differ slightly in their genes. Since the progeny gets half of the DNA from each parent, we have that new combinations can emerge; for example, if the mother is AA for some allele and the father aa, their offspring will be Aa, a new genotype. This might have different implications (for example, the recessive gene for thalassemia also provides resistance to malaria). Finally, during meiosis, there is also an event called crossover that increases the genetic variation of the offspring.
3 0
3 years ago
Other questions:
  • Hi:) Someone can help me please:"3
    15·2 answers
  • Jason was part of team that had to calculate the incoming solar radiation and outgoing terrestrial infrared radiation. What did
    11·1 answer
  • The area of triangle LMN is 18 ft2 and the area of FGH is 24 ft2. If triangle LMN is equivalent to triangle FGH, what is the rat
    8·2 answers
  • What is made from an alloy
    11·1 answer
  • The equation shown represents cellular respiration. Glucose + X → Y + Water + Energy What do X and Y most likely represent? Grou
    12·1 answer
  • Choose all the answers that apply. Tall pea plants are dominant over dwarf pea plants. If two hybrids (Tt) are crossed _____. 50
    10·2 answers
  • Which macromolecules have a basic unit that is composed of phosphate, a sugar ring and one of five difirent bases
    11·1 answer
  • How do the four female hormones control the menstrual cycle
    9·2 answers
  • Help pls
    6·1 answer
  • What is the benifit of flowers<br>​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!